ID: 1070584060

View in Genome Browser
Species Human (GRCh38)
Location 10:77747782-77747804
Sequence GCCCGAGCCTGAACCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070584060_1070584065 -5 Left 1070584060 10:77747782-77747804 CCAGGCAGGGTTCAGGCTCGGGC No data
Right 1070584065 10:77747800-77747822 CGGGCTTAGGGTGTCCGGAAGGG No data
1070584060_1070584066 -4 Left 1070584060 10:77747782-77747804 CCAGGCAGGGTTCAGGCTCGGGC No data
Right 1070584066 10:77747801-77747823 GGGCTTAGGGTGTCCGGAAGGGG No data
1070584060_1070584064 -6 Left 1070584060 10:77747782-77747804 CCAGGCAGGGTTCAGGCTCGGGC No data
Right 1070584064 10:77747799-77747821 TCGGGCTTAGGGTGTCCGGAAGG No data
1070584060_1070584067 1 Left 1070584060 10:77747782-77747804 CCAGGCAGGGTTCAGGCTCGGGC No data
Right 1070584067 10:77747806-77747828 TAGGGTGTCCGGAAGGGGAATGG No data
1070584060_1070584063 -10 Left 1070584060 10:77747782-77747804 CCAGGCAGGGTTCAGGCTCGGGC No data
Right 1070584063 10:77747795-77747817 AGGCTCGGGCTTAGGGTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070584060 Original CRISPR GCCCGAGCCTGAACCCTGCC TGG (reversed) Intergenic
No off target data available for this crispr