ID: 1070584067

View in Genome Browser
Species Human (GRCh38)
Location 10:77747806-77747828
Sequence TAGGGTGTCCGGAAGGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070584060_1070584067 1 Left 1070584060 10:77747782-77747804 CCAGGCAGGGTTCAGGCTCGGGC No data
Right 1070584067 10:77747806-77747828 TAGGGTGTCCGGAAGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070584067 Original CRISPR TAGGGTGTCCGGAAGGGGAA TGG Intergenic
No off target data available for this crispr