ID: 1070587260

View in Genome Browser
Species Human (GRCh38)
Location 10:77775691-77775713
Sequence CCAAGGGAGGTGGGAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070587260_1070587268 -2 Left 1070587260 10:77775691-77775713 CCTCTGGCTCCCACCTCCCTTGG No data
Right 1070587268 10:77775712-77775734 GGCCATGCTGTGTCCCTTGAGGG No data
1070587260_1070587272 12 Left 1070587260 10:77775691-77775713 CCTCTGGCTCCCACCTCCCTTGG No data
Right 1070587272 10:77775726-77775748 CCTTGAGGGATGAGCACACCTGG No data
1070587260_1070587267 -3 Left 1070587260 10:77775691-77775713 CCTCTGGCTCCCACCTCCCTTGG No data
Right 1070587267 10:77775711-77775733 TGGCCATGCTGTGTCCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070587260 Original CRISPR CCAAGGGAGGTGGGAGCCAG AGG (reversed) Intergenic
No off target data available for this crispr