ID: 1070587611

View in Genome Browser
Species Human (GRCh38)
Location 10:77778734-77778756
Sequence TGGTCCTCCAGTACGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070587611_1070587618 0 Left 1070587611 10:77778734-77778756 CCACCCACCGTACTGGAGGACCA No data
Right 1070587618 10:77778757-77778779 CCGACAACTCCTAGTCCTCAGGG No data
1070587611_1070587622 26 Left 1070587611 10:77778734-77778756 CCACCCACCGTACTGGAGGACCA No data
Right 1070587622 10:77778783-77778805 ACTCCCTTCCATATTCTTCTTGG No data
1070587611_1070587624 29 Left 1070587611 10:77778734-77778756 CCACCCACCGTACTGGAGGACCA No data
Right 1070587624 10:77778786-77778808 CCCTTCCATATTCTTCTTGGTGG No data
1070587611_1070587616 -1 Left 1070587611 10:77778734-77778756 CCACCCACCGTACTGGAGGACCA No data
Right 1070587616 10:77778756-77778778 ACCGACAACTCCTAGTCCTCAGG No data
1070587611_1070587619 1 Left 1070587611 10:77778734-77778756 CCACCCACCGTACTGGAGGACCA No data
Right 1070587619 10:77778758-77778780 CGACAACTCCTAGTCCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070587611 Original CRISPR TGGTCCTCCAGTACGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr