ID: 1070588129

View in Genome Browser
Species Human (GRCh38)
Location 10:77781481-77781503
Sequence GCCTCCAAGCACATCACCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070588125_1070588129 21 Left 1070588125 10:77781437-77781459 CCGTCTCAGTGAGGGGGATACCA 0: 1
1: 0
2: 5
3: 8
4: 101
Right 1070588129 10:77781481-77781503 GCCTCCAAGCACATCACCCACGG 0: 1
1: 0
2: 1
3: 17
4: 157
1070588124_1070588129 22 Left 1070588124 10:77781436-77781458 CCCGTCTCAGTGAGGGGGATACC 0: 1
1: 1
2: 6
3: 5
4: 88
Right 1070588129 10:77781481-77781503 GCCTCCAAGCACATCACCCACGG 0: 1
1: 0
2: 1
3: 17
4: 157
1070588128_1070588129 -8 Left 1070588128 10:77781466-77781488 CCATGCAGCATCTTGGCCTCCAA 0: 1
1: 1
2: 8
3: 19
4: 204
Right 1070588129 10:77781481-77781503 GCCTCCAAGCACATCACCCACGG 0: 1
1: 0
2: 1
3: 17
4: 157
1070588119_1070588129 30 Left 1070588119 10:77781428-77781450 CCATGGTGCCCGTCTCAGTGAGG 0: 1
1: 2
2: 4
3: 8
4: 117
Right 1070588129 10:77781481-77781503 GCCTCCAAGCACATCACCCACGG 0: 1
1: 0
2: 1
3: 17
4: 157
1070588126_1070588129 1 Left 1070588126 10:77781457-77781479 CCAGAGAAGCCATGCAGCATCTT 0: 1
1: 8
2: 4
3: 14
4: 188
Right 1070588129 10:77781481-77781503 GCCTCCAAGCACATCACCCACGG 0: 1
1: 0
2: 1
3: 17
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070588129 Original CRISPR GCCTCCAAGCACATCACCCA CGG Intergenic
900136300 1:1118515-1118537 GCCTCCAGGGACATCTCGCATGG - Intergenic
902129076 1:14243054-14243076 CCCTTCAATCACATCTCCCATGG + Intergenic
905053899 1:35076671-35076693 GCCTGTAATCACAGCACCCAGGG + Intronic
906017387 1:42593911-42593933 GCTTCCAAGCTCATGGCCCAGGG + Intronic
910036205 1:82792041-82792063 CCCTCAAAGCAGATCACCTATGG + Intergenic
910342554 1:86204322-86204344 ACCGCCAATCACTTCACCCAAGG + Intergenic
913286329 1:117230039-117230061 GCTTCCAACCACTCCACCCAAGG + Intergenic
913555822 1:119966043-119966065 GCCTTCAAGAATATGACCCATGG + Intronic
915625826 1:157113520-157113542 ACCTCCAGGCCCATCACCCAGGG - Intergenic
917074063 1:171185290-171185312 GCCTCCCAGCACACAACCAAGGG + Exonic
918019595 1:180673601-180673623 GCCTCCCATCACATCAGCAACGG + Intronic
918152741 1:181812367-181812389 GCATCCATGCAAACCACCCATGG - Intergenic
921592567 1:217021600-217021622 GACTCCATTCAAATCACCCAGGG + Intronic
921725756 1:218521549-218521571 GCCTCCAAGTCCAGCAGCCAGGG - Intergenic
923043628 1:230337882-230337904 GCTTCCATGAACATCACCAAAGG + Intronic
1064032192 10:11889946-11889968 GCCTCCAAGCACGAGACCCCAGG + Intergenic
1064253548 10:13725392-13725414 GCCTCCAAGCTTGTCACCCTGGG + Intronic
1068498257 10:57812970-57812992 GCCTCCAAGTACATCATATAGGG + Intergenic
1069905070 10:71727392-71727414 GCCACCAAGCACCTGCCCCAGGG - Intronic
1070405333 10:76089579-76089601 GCCTCCAAGCATAACAGACAAGG - Intronic
1070588129 10:77781481-77781503 GCCTCCAAGCACATCACCCACGG + Intergenic
1070618133 10:77985215-77985237 GCCTCCATGAACATCACCCTGGG - Exonic
1074401968 10:113149101-113149123 GCCACCCACCACTTCACCCAAGG + Intronic
1074793721 10:116919723-116919745 GCCACCCAGCAAATCACCAAAGG + Intronic
1075009297 10:118853965-118853987 ACCTCCACGCTCATCAGCCAAGG + Intergenic
1075317610 10:121465406-121465428 TGCTCCAAGCACATGTCCCACGG - Intergenic
1076440724 10:130479551-130479573 GGCTCAAATCGCATCACCCAGGG - Intergenic
1078526601 11:12106257-12106279 TCCTCCAAGGACAGCTCCCAAGG + Intronic
1083762890 11:64828311-64828333 TCCTCCAAGCCCATCGCCCCTGG + Intronic
1083814593 11:65125544-65125566 GTCTACAAGGACATCACGCATGG + Exonic
1084203257 11:67576346-67576368 GCCTCCCACCCCATCACTCAAGG - Intergenic
1084437657 11:69153760-69153782 ACCACCAGGCACATCCCCCAGGG - Intergenic
1084690151 11:70720396-70720418 TCCTCCAGTCCCATCACCCATGG - Intronic
1085252888 11:75155198-75155220 TCCTCCCAGCAGACCACCCAAGG + Intronic
1085382727 11:76134962-76134984 GCCTCCCATCAGATCAGCCATGG + Intronic
1089418641 11:118314588-118314610 GCCTCAAAGCCCCTCACTCAGGG + Intronic
1091060751 11:132459312-132459334 TTCTCCAAGCACAAGACCCAGGG - Intronic
1097190580 12:57217553-57217575 GCCTCCCATCACATTTCCCACGG + Intronic
1098227860 12:68343139-68343161 GCCTCCAAACACATCCCTCAAGG + Intergenic
1108163262 13:47665216-47665238 GCCTGCAAGCTCAGCTCCCATGG + Intergenic
1117254425 14:53963617-53963639 GCCTCCACGCACGTCAGCGAAGG + Intergenic
1118130562 14:62958326-62958348 ACCTCCATGGATATCACCCAAGG - Intronic
1119616244 14:76100862-76100884 GTCTCCATGCACATACCCCACGG + Intergenic
1119689515 14:76660431-76660453 GCCTCCAAAAGCTTCACCCATGG - Intergenic
1123664702 15:22599119-22599141 GCCTGCAATCCCAGCACCCAGGG - Intergenic
1124318536 15:28693557-28693579 GCCTGCAATCCCAGCACCCAGGG - Intergenic
1124322588 15:28726157-28726179 GCCTGCAATCCCAGCACCCAGGG - Intronic
1124322691 15:28726743-28726765 GCCTGCAATCCCAGCACCCAGGG - Intronic
1124523522 15:30426877-30426899 GCCTGCAATCCCAGCACCCAGGG - Intergenic
1124523600 15:30427321-30427343 GCCTGCAATCCCAGCACCCAGGG - Intergenic
1124535067 15:30538894-30538916 GCCTGCAATCCCAGCACCCAGGG + Intergenic
1124535145 15:30539337-30539359 GCCTGCAATCCCAGCACCCAGGG + Intergenic
1124564908 15:30803878-30803900 GCCTGCAATCCCAGCACCCAGGG + Intergenic
1124763508 15:32468260-32468282 GCCTGCAATCCCAGCACCCAGGG - Intergenic
1124763583 15:32468707-32468729 GCCTGCAATCCCAGCACCCAGGG - Intergenic
1124775043 15:32580344-32580366 GCCTGCAATCCCAGCACCCAGGG + Intergenic
1124775120 15:32580789-32580811 GCCTGCAATCCCAGCACCCAGGG + Intergenic
1126095653 15:45088044-45088066 GACTCAGAGTACATCACCCACGG - Intergenic
1127685140 15:61336213-61336235 GACTCCAAACACATCACCCTGGG + Intergenic
1128154808 15:65385587-65385609 GCCTCCCAGCAGGTGACCCAGGG - Intronic
1129869897 15:78933487-78933509 GCCTCCCAGGTCATCACCCTAGG + Intronic
1130621150 15:85463822-85463844 GCCACCAGCAACATCACCCAGGG - Intronic
1134841914 16:17408529-17408551 ACCTAGAAGCACATCAACCAAGG - Intronic
1137269463 16:46893899-46893921 GCCCACAGGCACAGCACCCATGG - Intronic
1137556349 16:49472840-49472862 GCGCCCAAGCCCCTCACCCAGGG + Intergenic
1138014199 16:53414042-53414064 GCCTGCAATCACAGCACCCCGGG - Intergenic
1138261432 16:55626115-55626137 GCCTCCAAGCTGATGACCAAAGG - Intergenic
1138862818 16:60778718-60778740 GCATCATAACACATCACCCAAGG - Intergenic
1139635003 16:68253162-68253184 ACCTCCAAACACATCCTCCATGG - Intronic
1140475701 16:75238401-75238423 GCCTCCCCGCACATCCCCCAGGG + Intronic
1140874966 16:79142272-79142294 GCCTCCAAGCATATAAAACAGGG + Intronic
1141613753 16:85198524-85198546 CCCTCCCAGCACATCACCACTGG - Intergenic
1145282448 17:21477878-21477900 ACTTCCAAACACATCACCCCAGG - Intergenic
1146937662 17:36822379-36822401 GCCCACAAGCCCCTCACCCAAGG - Intergenic
1150987960 17:70220608-70220630 TCCTCCAAGACCATCACCCATGG - Intergenic
1151386362 17:73757763-73757785 GCCTCCCACCCCACCACCCACGG + Intergenic
1151834487 17:76574045-76574067 GCCTCAAACCACCTCACTCACGG - Intronic
1152648882 17:81482814-81482836 GCCTCCCAGCACCCCACCCCTGG - Intergenic
1152734310 17:81989649-81989671 CCATCCAAGGAAATCACCCAGGG - Intronic
1152887429 17:82860682-82860704 GCCTGCAAACACAGCACACAAGG - Intronic
1153056284 18:949655-949677 GTGCCCAAGCACATCCCCCAGGG - Intergenic
1153410017 18:4782767-4782789 TCCTCCAGGGACCTCACCCAGGG + Intergenic
1156594524 18:38532891-38532913 GCCACCTAGCACAGCACCAAGGG + Intergenic
1157815736 18:50728442-50728464 GCCCCCAAGCAGATCCACCAGGG + Intronic
1158344194 18:56498922-56498944 GCTTCCAAGCACAACTCCAAAGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160785014 19:896337-896359 TCCTACAAGCTCCTCACCCAAGG + Intergenic
1163388449 19:17014899-17014921 ACCTCCAAGCAGATCACCTGGGG + Intronic
1168422255 19:56212231-56212253 TCCTCCAAACGCAGCACCCATGG - Intergenic
926197223 2:10771372-10771394 GCCTCCCAGCCCAGCACCCAGGG - Intronic
927508592 2:23630248-23630270 GCCTGCAAGCACACCGGCCACGG - Intronic
930023947 2:47018775-47018797 TCCTCCCAGCACCTCATCCAGGG + Intronic
937329916 2:121019991-121020013 GCCTCCCAGCTCATCAGCCCAGG + Intergenic
940801394 2:158136933-158136955 CCCTCCAGGCACATCACCCTTGG + Intergenic
948440504 2:237984128-237984150 GCATCCCAGCACATCACCTCTGG + Intronic
949017196 2:241720180-241720202 GCCTCCAAGGGCATCATCCTGGG + Intronic
1169640132 20:7742181-7742203 CCCTGCAAGCACATCATCTAAGG - Intergenic
1169706210 20:8508011-8508033 GCCTCCAATGACTACACCCAAGG + Intronic
1170388800 20:15850202-15850224 GCCACCAAGAGCATCACCCTGGG + Intronic
1172610926 20:36251978-36252000 GCCACAAAGCATATCACCCAGGG - Intronic
1180197587 21:46206963-46206985 GCCTCCATGCACAGCCACCAGGG + Intronic
1181308303 22:21929411-21929433 GCTTCCAAGTCCATCACACAGGG - Intronic
1181734057 22:24868289-24868311 TCCTGCAAGCACATCCCCCAGGG - Intronic
1182442035 22:30370353-30370375 ACCTCCAAGCCCACCACCAAGGG + Exonic
1182650145 22:31845079-31845101 GCCACCAAGCGCATCACGGAGGG + Exonic
1182759124 22:32707791-32707813 GCCTCCAAGCCCCTTCCCCATGG - Intronic
1183786399 22:40031414-40031436 GCCTCCAAGCAAGTCAGCCAAGG + Exonic
1184277630 22:43419294-43419316 GCCTCCACCCACAGCCCCCAAGG - Intronic
1184499969 22:44865637-44865659 GCCACCAAGGACCTCATCCAAGG - Intergenic
1185232691 22:49692597-49692619 GTCCCTAAGCCCATCACCCAGGG - Intergenic
950008532 3:9706012-9706034 GCCTCCAATCACCTCTCCCAGGG - Exonic
950631891 3:14287444-14287466 GCCACCAAGCACAGGATCCAAGG + Intergenic
951840142 3:27025525-27025547 GCCTCCATGCAAATCTTCCATGG - Intergenic
952855854 3:37770320-37770342 TGCTCCAAGCACATCATCCTGGG - Intronic
953108298 3:39907493-39907515 GCCTCCAAGGACACCACAGAAGG - Intronic
953195881 3:40732503-40732525 GCCTCCAAACACATCCCCACTGG - Intergenic
953390484 3:42531051-42531073 GCCTGCAAGGATATCAGCCAAGG + Intronic
959926796 3:111931109-111931131 GCTTCTAAGCACATCACAGAAGG - Intronic
963790520 3:149578048-149578070 ACCTCCAGGCACATATCCCAAGG + Intronic
968575540 4:1364383-1364405 GGCTCCAAGCCCAGCCCCCACGG - Intronic
968691451 4:1992351-1992373 TCCTCCACGCACGTCGCCCATGG - Intronic
969516242 4:7649639-7649661 GCCTCCAAGCCCAGTGCCCAGGG - Intronic
969638037 4:8380757-8380779 GCCTCCCTGCACAACACTCATGG + Intronic
970780975 4:19737098-19737120 GCCTCCAATCACAGGATCCAGGG - Intergenic
974662852 4:64917084-64917106 GACTCCAAGCAAGTCACCTAAGG - Intergenic
977220009 4:94327417-94327439 GCACCCAAGCACATTATCCAGGG - Intronic
984957247 4:185057781-185057803 GCACACAAGCACATCACTCAAGG - Intergenic
986663849 5:10082841-10082863 GCCTCGACCCACAACACCCAAGG + Intergenic
996734767 5:126748451-126748473 GGCTCCAAGCACAAAACCCAGGG + Intergenic
997599557 5:135130081-135130103 GCCCCTCAGCACATCACCCGAGG + Intronic
997794012 5:136789319-136789341 GCCTAGATGCACATCACCCTAGG - Intergenic
997846941 5:137295100-137295122 GCATCCCAGCACTTGACCCACGG + Intronic
997853647 5:137354551-137354573 GCCTCCAAGCACATCTCTCATGG + Intronic
999146904 5:149402306-149402328 GGCTCCAAGCCAACCACCCAGGG + Intronic
999451708 5:151683239-151683261 GCCTACAGGCACATCATGCAGGG + Intronic
1000106900 5:158068358-158068380 GCCTAAAAGCAAATCAGCCAGGG - Intergenic
1001184916 5:169561117-169561139 GCAGCCAACCACATCACCCAAGG + Intergenic
1002430487 5:179200701-179200723 GGCATCAAACACATCACCCAAGG + Intronic
1002522317 5:179798629-179798651 GCGTTCCAGCACAGCACCCAGGG + Intronic
1003867975 6:10380977-10380999 GCCTCCAACCACATTAGCCATGG + Intergenic
1007085283 6:39140066-39140088 ACTTCTATGCACATCACCCACGG + Intergenic
1007707479 6:43799613-43799635 GCCTTCAAGCACAACCCCCACGG - Intergenic
1014456303 6:121638465-121638487 GCTTCCAAGCACTTCACATAAGG - Intergenic
1015453043 6:133392497-133392519 GCCTCCAAGCACCTGAGTCACGG - Intronic
1017020636 6:150137232-150137254 GCCTCCATGCCCAGCACCCCAGG - Intergenic
1017093968 6:150787709-150787731 GCTTCCAAACACAACACCCTGGG + Intronic
1022961400 7:35429956-35429978 GGATCTCAGCACATCACCCAGGG + Intergenic
1024995662 7:55271585-55271607 GCCAACAAGCACCTCACGCAAGG + Intergenic
1026807691 7:73438157-73438179 GCCTCAAAGCACAGCCCCCGGGG - Intergenic
1029624737 7:101713582-101713604 GCCTCCTAACTCATCCCCCATGG - Intergenic
1030019847 7:105262648-105262670 GCCTCCAACAACAACACCCTAGG + Intronic
1030291882 7:107880886-107880908 GCCTCCTGTCACATCAGCCAAGG - Intergenic
1037513072 8:19603237-19603259 GCCTCCAAACACCTCTCCAAAGG + Intronic
1045354483 8:101373393-101373415 GCATCGCAGCAAATCACCCAAGG - Intergenic
1048820539 8:138376335-138376357 GCCTCCAAAGCCATCACCCTAGG + Intronic
1052831082 9:33216293-33216315 GCCTGCTAGCACATTCCCCAGGG - Intergenic
1053303108 9:36965567-36965589 GCCTCCCTGCACAGCTCCCATGG - Intronic
1054825393 9:69567850-69567872 GCCTCCAAGCTCGTTCCCCAGGG + Intronic
1056082052 9:83105877-83105899 GCCTAGAAGAACACCACCCAAGG + Intergenic
1057823419 9:98352571-98352593 GCATCCATGCACACCATCCATGG - Intronic
1059044900 9:110855859-110855881 CCCTCCAAGCACTTCATCAATGG + Intergenic
1059362338 9:113754579-113754601 GCCACCAAGCACATTTCACATGG + Intergenic
1061077158 9:128348621-128348643 GCCTCCAAGCACAGAACACCTGG + Exonic
1061170199 9:128947984-128948006 GCCTCCCATCTCCTCACCCAGGG + Intronic
1061509965 9:131054376-131054398 GCCTCCCAAAACATTACCCATGG - Intronic
1061689073 9:132309812-132309834 GCCCCCACCCCCATCACCCATGG - Intronic
1061782512 9:133004279-133004301 TCCTCCAACCACCTCACCCTGGG + Intergenic
1062121873 9:134838277-134838299 GTCTCCAGACACATCTCCCAGGG + Intronic
1062361852 9:136192030-136192052 GCCACCACGCACCTCGCCCACGG + Intergenic
1062516812 9:136940970-136940992 TCCTCCAGGCACCTCGCCCACGG - Exonic
1062518655 9:136948204-136948226 GCCACCAACCACAGCACCCAAGG - Intronic
1185541909 X:908917-908939 GCCTCAAAGCTCATCTCCTAAGG + Intergenic
1188327595 X:28824572-28824594 TCCTCCTACCACACCACCCAGGG + Intronic
1195917656 X:109951825-109951847 GCCCCCAACCTCATCTCCCATGG + Intergenic
1196458552 X:115906752-115906774 ACCTCCTTGCACATGACCCATGG + Intergenic
1201177335 Y:11316798-11316820 GGCTCCTTGCACATCAGCCAGGG - Intergenic