ID: 1070592634

View in Genome Browser
Species Human (GRCh38)
Location 10:77811659-77811681
Sequence TAGCCAGGAGTTGTGGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 385}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070592634_1070592645 2 Left 1070592634 10:77811659-77811681 CCCGGGGCCACAACTCCTGGCTA 0: 1
1: 0
2: 1
3: 32
4: 385
Right 1070592645 10:77811684-77811706 ATGGGCCCCTGCTGGTCAGGGGG No data
1070592634_1070592643 0 Left 1070592634 10:77811659-77811681 CCCGGGGCCACAACTCCTGGCTA 0: 1
1: 0
2: 1
3: 32
4: 385
Right 1070592643 10:77811682-77811704 CCATGGGCCCCTGCTGGTCAGGG No data
1070592634_1070592644 1 Left 1070592634 10:77811659-77811681 CCCGGGGCCACAACTCCTGGCTA 0: 1
1: 0
2: 1
3: 32
4: 385
Right 1070592644 10:77811683-77811705 CATGGGCCCCTGCTGGTCAGGGG No data
1070592634_1070592641 -1 Left 1070592634 10:77811659-77811681 CCCGGGGCCACAACTCCTGGCTA 0: 1
1: 0
2: 1
3: 32
4: 385
Right 1070592641 10:77811681-77811703 ACCATGGGCCCCTGCTGGTCAGG No data
1070592634_1070592640 -6 Left 1070592634 10:77811659-77811681 CCCGGGGCCACAACTCCTGGCTA 0: 1
1: 0
2: 1
3: 32
4: 385
Right 1070592640 10:77811676-77811698 TGGCTACCATGGGCCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070592634 Original CRISPR TAGCCAGGAGTTGTGGCCCC GGG (reversed) Intronic
900300550 1:1974660-1974682 CATCCAGGACATGTGGCCCCGGG - Intronic
900474036 1:2868051-2868073 AAGCTAGGGCTTGTGGCCCCCGG + Intergenic
900605954 1:3523603-3523625 GAGCCAGGCTTTGTGGGCCCAGG - Intronic
901074451 1:6544373-6544395 TAGCCAGGCATGGTGGCCCATGG + Intronic
904157576 1:28497405-28497427 TAGCCAGGTGTGGTGGCGCCTGG + Exonic
904180824 1:28665520-28665542 TTGCCAGAAGTGGTGGCTCCAGG + Intergenic
904373368 1:30064965-30064987 TACCCAGGAGATGGGGCCCTGGG - Intergenic
904640977 1:31928552-31928574 TAGCCAGGTATTGTGGCGCATGG + Intronic
905211664 1:36378602-36378624 TAGCCAGGCGTGGTGGCGCACGG - Intronic
905564098 1:38949612-38949634 TAGCCAGGAGTGGTGGCGAGTGG + Intergenic
907597545 1:55733574-55733596 TAGCCAGGATTCGTGGGTCCAGG + Intergenic
907872344 1:58454596-58454618 AAGCAAGGAGGTGTGGCCCTCGG - Intronic
909197442 1:72645987-72646009 TAGCCAGGTGTTGTGGTGCATGG + Intergenic
910010340 1:82453465-82453487 TAGGCAGGATTTATGGCTCCAGG + Intergenic
910778418 1:90899759-90899781 TAGCCAGGAGTGGTGGTACATGG + Intergenic
913037654 1:114987517-114987539 TAGCCAGGTGTGGTGGCACATGG + Intronic
914870168 1:151467050-151467072 TAGCCAGGTGTGGTGGCACGCGG - Intergenic
915414750 1:155732876-155732898 TAGCCAGGCGTCGTGGCGCGTGG + Intronic
915524059 1:156465468-156465490 AAGACAGGAGTTGGGGTCCCAGG + Exonic
915952416 1:160198356-160198378 TAGCCAGGTGTGGTGGCGCATGG + Intronic
916855197 1:168741911-168741933 TATTCAGCAGATGTGGCCCCTGG - Intergenic
917003432 1:170385883-170385905 CAGCCAGGAGTTGTGCAACCTGG + Intergenic
917783692 1:178428730-178428752 TAGGCATGAGCTGTGGCACCAGG + Intronic
918309406 1:183275024-183275046 CAGCCAGGAGTTCCTGCCCCAGG + Intronic
918755517 1:188336363-188336385 TAGCAAGGATTTATGGCTCCAGG - Intergenic
919427722 1:197453720-197453742 TAGCCAGGTGTGGTGGCACATGG - Intronic
919998841 1:202779331-202779353 TAGCCAGGCGTGGTGGCACGCGG + Intronic
920382980 1:205546429-205546451 TAGCCAGGATTTGAGCCCTCTGG - Intergenic
920866510 1:209758039-209758061 TAGCCAGGGGCTGTGGCTCAGGG + Intronic
921682973 1:218056073-218056095 TAGCCAGGCGTGGTGGCGCCTGG - Intergenic
922810893 1:228414962-228414984 TCGGCAGAAGTTGTGGCCACAGG + Exonic
922917116 1:229267779-229267801 TAGCCAGGTGTGGTGGCGCGTGG + Intergenic
923926674 1:238636240-238636262 TAGCCAGGTGTGGTGGCACGTGG + Intergenic
924510687 1:244727128-244727150 TAGCCAGGCGTGGTGGCCTGTGG - Intergenic
924713505 1:246551027-246551049 TAGCCAGGCATGGTGGCGCCTGG + Intronic
1064664408 10:17636185-17636207 TATGCAGGGGATGTGGCCCCAGG + Intergenic
1065165063 10:22967516-22967538 TAGCCAGGATTTGTGGGTCCAGG - Intronic
1066584575 10:36918502-36918524 TAGCTAGGAGTGGTGGCACATGG + Intergenic
1067441955 10:46313515-46313537 TAGCCAGCACTCCTGGCCCCAGG - Intronic
1068010040 10:51436958-51436980 TAGCCAGGCCTTGTCACCCCTGG + Intronic
1070070597 10:73085527-73085549 TAGCCAGGCGTGGTGGCACATGG - Intronic
1070592634 10:77811659-77811681 TAGCCAGGAGTTGTGGCCCCGGG - Intronic
1071485259 10:86097016-86097038 AAGCCTGGAGTTGTTGCCCAAGG - Intronic
1072153998 10:92707228-92707250 TAGCCAGGTGTGGTGGCACGTGG + Intergenic
1073438870 10:103540433-103540455 TAGCCAGGTGTGGTGGCACACGG - Intronic
1073995681 10:109313328-109313350 TAGCCAGGATTCATGGGCCCAGG - Intergenic
1075352804 10:121739777-121739799 TAGTCAGGAGTTGTTGCCGATGG + Intergenic
1075576831 10:123583928-123583950 CAGCCAGGAGGTGTGGCTCCGGG + Intergenic
1075733647 10:124651251-124651273 TTTCCAGGAGCTGAGGCCCCAGG + Intronic
1076884340 10:133254757-133254779 TGGCCAGGAGCTGGGGCCACCGG + Intergenic
1077085057 11:745952-745974 TAGCCAGGCGTGGTGGCACATGG - Intergenic
1077887190 11:6394886-6394908 AAGACAGGAGCTGTCGCCCCAGG + Exonic
1079063010 11:17266006-17266028 TAGCCAGGAGTGGTGGCGGGCGG + Intronic
1079199675 11:18365230-18365252 TAGCCAGGTGTGGTGGCTCATGG + Intronic
1079203298 11:18393544-18393566 TAGCCGGGCGTGGTGGCGCCTGG + Intergenic
1080381724 11:31778759-31778781 TGGCCAGGACTTGTGGGCACTGG - Intronic
1080908076 11:36566801-36566823 TAGTGAGCAGCTGTGGCCCCAGG + Intronic
1082630658 11:55538172-55538194 TAGCCAGATGTTGTGGCACATGG - Intergenic
1083230973 11:61319058-61319080 TAGCCAGGCGTGGTGGCGCATGG + Intronic
1083602851 11:63959690-63959712 TAGCCAGGCGTGGTGGCACGTGG + Intergenic
1084216380 11:67648931-67648953 GTGCCAGGAGGAGTGGCCCCTGG - Intronic
1084375752 11:68776251-68776273 TAGCCAGGTGTGGTGGCACATGG + Intronic
1084721896 11:70911704-70911726 TAGCCATGAGTTGTACTCCCTGG - Intronic
1084884791 11:72196691-72196713 TAGCCAGGTGTGGTGGCACATGG - Intergenic
1085054206 11:73394582-73394604 TAGCCAGAAGAAGTGGCCCGAGG + Exonic
1086097054 11:83060965-83060987 TAGCCTGGAGTTGTTGTCCGAGG - Intronic
1087141411 11:94768788-94768810 TTGACTGAAGTTGTGGCCCCGGG + Intronic
1088063022 11:105680300-105680322 TAGCCAGGATTTATGGGTCCAGG - Intronic
1088713003 11:112525085-112525107 CAGCCTGTAGCTGTGGCCCCTGG + Intergenic
1088725589 11:112631647-112631669 GAGCCTGGAGATGTGGCCACAGG + Intergenic
1089262322 11:117231866-117231888 TATCCAGGAATTCTGGGCCCTGG + Intronic
1089549943 11:119266055-119266077 TAGCCAGGCATAGTGGCCTCTGG + Intronic
1089903816 11:122015045-122015067 TAGCCAGGATTCGTGGGCCCAGG + Intergenic
1090012365 11:123056579-123056601 TAGCCAGGAATGGTGGCGCATGG + Intergenic
1090787265 11:130060918-130060940 TAGCCAGGTGTGGTGGCGCGTGG + Intergenic
1092130411 12:6108146-6108168 TAGCCAGGCGTGGTGACACCTGG + Intronic
1092188696 12:6501331-6501353 TAGCCAGGTGTCGTGACCCTGGG - Intronic
1092481146 12:8860187-8860209 TAGCCAGGTGTAGTGGCACGTGG - Intronic
1092840676 12:12538146-12538168 TAGCCAGGCGTGGTGGCGCACGG - Intronic
1093366161 12:18302237-18302259 TAGGCAGGTTTTGGGGCCCCTGG + Intronic
1093519492 12:20031883-20031905 TAGCCAGGCGTGGTGGCCCATGG + Intergenic
1093924232 12:24892570-24892592 TAGCCAGGAGCAGTGGCTCATGG + Intronic
1094717599 12:33028779-33028801 TAGCCAGGCGTGGTGGCACATGG + Intergenic
1095856056 12:46862238-46862260 TAGCCAGGATTTATGGGTCCAGG - Intergenic
1096229491 12:49889247-49889269 CAGCCTGTAGTTGGGGCCCCAGG - Intronic
1097111236 12:56659806-56659828 TAGCCAGGAGTGGTGGCACATGG + Intergenic
1097291020 12:57914921-57914943 TAAAGAGGAGTTGTGGCTCCTGG + Intergenic
1097792899 12:63833578-63833600 TAGCCAGGCATGGTGGCACCTGG + Intergenic
1098716297 12:73831239-73831261 TAGCCAGGACTTATGGATCCAGG + Intergenic
1099508762 12:83508621-83508643 TAGCCAGGATTTGTGGGTCCAGG + Intergenic
1101112948 12:101504331-101504353 TAGCCAGGCGTGGTGGCACGTGG - Intergenic
1101366820 12:104079753-104079775 TAACCAGCACTTGTAGCCCCAGG + Intronic
1101682360 12:106981664-106981686 TAGCCAGGTGTGGTGGCTCATGG - Intronic
1103487116 12:121290542-121290564 TAGCCAGGCGTGGTGGCGCAGGG + Intronic
1103665332 12:122559719-122559741 TAGCCAGGTGTGGTGGCAGCGGG - Intronic
1103838743 12:123845645-123845667 TAGCCAGGTGTGGTGGACCTGGG + Exonic
1109636039 13:65118974-65118996 TAGCCAGGTGTGGTGGTGCCAGG + Intergenic
1111057597 13:82971594-82971616 TAGCCAGGATTTATGGGTCCAGG - Intergenic
1111180690 13:84660349-84660371 AACCCAGGAATAGTGGCCCCTGG - Intergenic
1111285851 13:86090908-86090930 AAGCCAGGTGATGTGGCCTCTGG - Intergenic
1111536112 13:89605176-89605198 TAGCCAGGATTTATGGGTCCAGG - Intergenic
1111930597 13:94509315-94509337 CAGCCAGGAGATGGGGACCCAGG - Intergenic
1112779889 13:102888521-102888543 TAGCCAGGCGTGGTGGCGCATGG + Intergenic
1112809898 13:103205858-103205880 TCCCCAGGAGGTGTGGCTCCAGG - Intergenic
1113849206 13:113408353-113408375 GAGCCAGGAGCTGTGGCTTCTGG + Intergenic
1114543338 14:23480251-23480273 TAGCCAGGTGTGGTGGCACGTGG - Intronic
1115238535 14:31232099-31232121 GGGCCAGGTGTAGTGGCCCCTGG - Intergenic
1116462464 14:45193310-45193332 TGGGCAGGACTTGTGTCCCCAGG - Intronic
1116927300 14:50652883-50652905 TAGCCAGGCGTGGTGGCACGTGG + Intronic
1117775664 14:59181421-59181443 AAGGAAGGAGATGTGGCCCCAGG - Intergenic
1118599571 14:67462489-67462511 TAGCCAGGTGTGGTGGCTCATGG - Intronic
1118605809 14:67502596-67502618 TAGCCAGGCGTGGTGGCACATGG - Intronic
1119546519 14:75476036-75476058 TAGCCAGGCGTGGTGGCACATGG - Intergenic
1120016690 14:79481916-79481938 GAGTCAAGAGTTGTGGGCCCAGG + Intronic
1122128442 14:99591618-99591640 GGCCCTGGAGTTGTGGCCCCAGG - Intronic
1122549841 14:102544017-102544039 TGGCCAGGGCTTGTGGCCCCTGG - Intergenic
1122579980 14:102765469-102765491 TAGCCAGGTGTGGTGGCACACGG + Intergenic
1123173004 14:106391560-106391582 TAGCCAGGTGTGGTGGCACGCGG - Intergenic
1123588340 15:21778419-21778441 TAGCCAGGCGTGGTGGCCCATGG - Intergenic
1123624979 15:22220982-22221004 TAGCCAGGCGTGGTGGCCCATGG - Intergenic
1125986407 15:44057249-44057271 TAGCCAGGCGTGGTGGCTACTGG - Intronic
1126587205 15:50300587-50300609 TAGCCAGGCGTGGTGGCACATGG - Intronic
1127904733 15:63368284-63368306 TGGCCTGGTGGTGTGGCCCCTGG + Intronic
1128498469 15:68211214-68211236 TAGCCGGTAGTTGGGGCCCCTGG + Intronic
1128745791 15:70113407-70113429 CAGCCAGGAGCTGGGGCCTCAGG - Intergenic
1128952876 15:71905639-71905661 TAGCCAGGCGTGGTGGTGCCCGG + Intronic
1131248601 15:90816876-90816898 TAGCCAGAAGTTGATACCCCTGG + Intergenic
1131377156 15:91935097-91935119 TAGCCAGGCGTGGTGGCACACGG - Intronic
1132077718 15:98836372-98836394 TAGCCAGCAGTGGTGGCACGTGG + Intronic
1132205759 15:99985014-99985036 TTGCCAGGAGGGGTGGCCGCGGG - Intronic
1132346252 15:101110910-101110932 TGGCCAGGTGCTGTGGTCCCAGG + Intergenic
1132744706 16:1431816-1431838 TGGCCAGGTGCAGTGGCCCCTGG + Intergenic
1132822954 16:1886004-1886026 TAGCCAGGAGTTGTGGTGCATGG + Intergenic
1135133007 16:19868226-19868248 TAGCCAGGTGTGGTGGCACACGG + Intronic
1136404902 16:30039267-30039289 TAGCCAGGCGTGGTGGCGCATGG - Intronic
1136558393 16:31023166-31023188 TAGCCAGGCGTGGTGGCTCATGG + Intergenic
1136592106 16:31223759-31223781 TAGCCAGGTGTGGTGGCACGTGG + Intronic
1136601178 16:31289933-31289955 TAGCCAGGTGTGGTGGCACATGG + Intronic
1136902874 16:34059769-34059791 TAGCCAGGCATTGTGGCACGTGG + Intergenic
1137329148 16:47472799-47472821 TAGCCAGGTGTTGTGGTGCCTGG + Intronic
1137674101 16:50295472-50295494 GGGCCAGGAGTGGTGGCCCACGG - Intronic
1138194506 16:55042688-55042710 TAGCCTGGAGAGGTGGCCCAGGG - Intergenic
1138202526 16:55100796-55100818 TAGCCAGGAGTACTTGGCCCTGG - Intergenic
1139217273 16:65138885-65138907 TAGCCAGGCGTGGTGGCGGCGGG + Intergenic
1141017647 16:80465642-80465664 TAGCCAGGTGTTGTGGTCTGTGG - Intergenic
1141817942 16:86425582-86425604 TAGCCAGGAGTCTGGGTCCCCGG - Intergenic
1141915572 16:87094221-87094243 CAGCCAGGAGTTGTAATCCCAGG - Intronic
1142262124 16:89047993-89048015 TGGCCAGGTGTGGTGGCCACTGG - Intergenic
1142400699 16:89856918-89856940 TAGCCAGGTGTGGTGGCACATGG + Intronic
1142944082 17:3410250-3410272 TAGCCAGGCGTGGTGGCACATGG - Intergenic
1143547716 17:7608469-7608491 TAGCCAGGCGTGGTGGCACATGG + Intronic
1143547854 17:7610078-7610100 TAGCCAGGCGTGGTGGCACATGG + Intronic
1143646677 17:8234841-8234863 GAGCCAGGAGTTGCAGTCCCAGG + Exonic
1143991973 17:10973436-10973458 TAGCCAGGCGTGGTGGCACATGG - Intergenic
1144870906 17:18370174-18370196 TAGCCAGGTGTGGTGGCACACGG + Intergenic
1146421559 17:32691109-32691131 TAGCCAGATGTTGTGGCACCTGG + Intronic
1148355068 17:46969985-46970007 GAGCCAGGAGATTTGACCCCCGG - Intronic
1148836114 17:50466781-50466803 CAGACAGGAATTGTGGCGCCTGG - Intronic
1149058484 17:52392557-52392579 TAGCCGGGAGTGGTGGCCGGCGG + Intergenic
1149806534 17:59622521-59622543 TAGCCAGGTGTGGTGGCTCATGG - Intronic
1150549196 17:66193013-66193035 TAGCCAGGCGTGGTGGCACACGG + Intergenic
1150581546 17:66478398-66478420 TAGCCAGGTGTGGTGGCACATGG - Intronic
1150721018 17:67614524-67614546 TAGCCAGGTGTGGTGGCACATGG + Intronic
1151724989 17:75878459-75878481 GAGACAGAAGTTGTGGCCGCAGG + Exonic
1151788844 17:76290925-76290947 CAGCCAGGAGTTGAGGCCAGGGG + Intronic
1151809478 17:76429394-76429416 TAGCCAGGAGTGGTGGCGCATGG + Intronic
1153000564 18:451599-451621 TAGCCAGGAGTGGTGGCAGGTGG + Intronic
1153339382 18:3958779-3958801 TAGCCAGTAGTTAAAGCCCCAGG + Intronic
1153701556 18:7699552-7699574 TAGCCAGGTGTGGTGGCACGTGG - Intronic
1154140806 18:11822456-11822478 TAGCCAGGCGTGGTGGCACGCGG + Intronic
1154216951 18:12422502-12422524 TAGCCAGGTGTAGTGGCACGCGG - Intronic
1156638138 18:39055888-39055910 CAGGCAGGAGTTGTGGCCTTTGG + Intergenic
1156652119 18:39236725-39236747 TAGCCAGGTGTAGTGGCAGCAGG - Intergenic
1156908929 18:42387816-42387838 TAGCCAGGCGTGGTGGCTCACGG - Intergenic
1157414174 18:47488533-47488555 TAGCCAGGACTTCTGGCTCCAGG - Intergenic
1158454859 18:57597181-57597203 TAGCCAGGCGTGGTGGCTCCTGG + Intergenic
1158931776 18:62330148-62330170 AAGACAGGAGCTGTGGCCCTTGG - Intronic
1159015913 18:63101563-63101585 TAGCCAGGGGCTCAGGCCCCAGG - Intergenic
1159370712 18:67524305-67524327 TAGCCAAGTGTGGTGGCCACTGG - Intergenic
1159558907 18:69973929-69973951 TAGCCAGGATTTGTGGGTCCAGG - Intergenic
1160377854 18:78427459-78427481 TAGCCAGGGGTTGGAGGCCCAGG - Intergenic
1161197356 19:2994193-2994215 TAGCCAGGTGTGGTGGCTCACGG + Intronic
1161915104 19:7222537-7222559 TAGCCAGCTGTGGTGGCCCATGG - Intronic
1161927942 19:7315287-7315309 TAGCCAGGCGTGGTGGCACATGG + Intergenic
1162606813 19:11715393-11715415 TAGCCAGGCGTGGTGGCACATGG - Intergenic
1163611299 19:18303257-18303279 TAGCCAGGTGTGGTGGCACGTGG - Intergenic
1163833044 19:19556600-19556622 TAGCCAGGAGTGGTGGCACATGG + Intergenic
1163880390 19:19915694-19915716 TAGCCAGGCGTTGTGGCATGCGG + Intronic
1164170422 19:22720090-22720112 TAGCCAGGCGTGGTGGCACATGG + Intergenic
1164187193 19:22880654-22880676 GAGCCAGGAGTTTGAGCCCCAGG - Intergenic
1164221303 19:23196704-23196726 TAGCCAGGTGTCGTGGCACATGG - Intergenic
1164243411 19:23409802-23409824 TGGCCAGTAGTTGTGGCTGCTGG - Intergenic
1164311218 19:24048183-24048205 TGGCCAGTACTTGTGGCCGCTGG + Intronic
1165843173 19:38801735-38801757 TTCCCATGAGTTATGGCCCCAGG + Exonic
1166079934 19:40437560-40437582 TAGCCAGGCGTAGTGGCACATGG - Intergenic
1166723782 19:45012901-45012923 TAGCCAGGTGTGGTGGCACATGG + Intronic
1167083572 19:47293770-47293792 TAGCCAGGTGTGGTGGCTCAGGG + Intronic
1167265805 19:48482745-48482767 GACCCAGGAGTTGGGGACCCCGG + Intergenic
1168698984 19:58424101-58424123 TAGCCAGGTGTGGTGGCGCATGG + Intergenic
925996810 2:9300085-9300107 TAGCCAGGCGTGGTGGCTCACGG + Intronic
926767076 2:16330892-16330914 CAGCCAGGACTTCTGACCCCTGG + Intergenic
927173307 2:20388315-20388337 GAGCCAGGAGTTCTGGGACCTGG + Intergenic
928004618 2:27553092-27553114 TTGGCAGGAGTTGCAGCCCCAGG + Intronic
928372790 2:30753227-30753249 TGACCAGGGGTTGTGTCCCCAGG + Intronic
928507028 2:31964553-31964575 TAGCCAGGTGTGGTGGCGCATGG + Intronic
928532362 2:32205811-32205833 TAGCCAGGCGTGGTGGCACATGG - Intronic
930027110 2:47035750-47035772 GAGGCAGGAATTGTGGCCCAGGG + Intronic
930693876 2:54391433-54391455 GGGTCAGGAGATGTGGCCCCAGG + Intergenic
932259904 2:70318350-70318372 TAGCCATGGCTTGTGGCTCCTGG + Intergenic
932273049 2:70427854-70427876 TAGCCAGATGTGGTGGCTCCTGG + Intergenic
932376839 2:71243936-71243958 GAGCCAGGAGTTGAGGGCCTGGG + Intergenic
932934445 2:76085836-76085858 TAGCCAGCTTTTGTGGTCCCAGG + Intergenic
935528689 2:104205519-104205541 TAGCCAGGTGTGGTGGCACATGG - Intergenic
936530210 2:113271151-113271173 TAGCTAGGAGTGGTGGCCACTGG - Intronic
937192733 2:120120284-120120306 TAGCCAGGCGTAGTGGCACGTGG + Intronic
937587458 2:123570245-123570267 TTGCCAGGAGTTTTAGCTCCAGG - Intergenic
937707854 2:124941878-124941900 TAGCCAGCAGTAGCAGCCCCTGG - Intergenic
939096185 2:137836281-137836303 TAGCCAGGAGATGGGGGACCTGG + Intergenic
944311723 2:198241120-198241142 GAGTCAGGAGATGTGGCCACTGG - Intronic
944648061 2:201799926-201799948 TAGCCAGGTGTGGTGGCACGTGG - Intronic
945204637 2:207319048-207319070 TAGCCAGGCGTTGTGGCAGGCGG + Intergenic
945207354 2:207345546-207345568 TAGCGAGGAGTTGTGATCCTTGG - Intergenic
945960173 2:216125341-216125363 TAGCCAGGTGTGGTGGCGCATGG - Intronic
947328386 2:229002368-229002390 TGGGAAGGAGTTGTGTCCCCGGG + Intronic
947464118 2:230326166-230326188 CAGCCTGGAGTTCTGGTCCCTGG + Intergenic
1169087628 20:2837245-2837267 TAGCCAGGAGTTGGAGCATCAGG - Intronic
1169495201 20:6108662-6108684 TAGCCAGGTGTTGTGGCACATGG + Intronic
1170076235 20:12422295-12422317 TAGCCAGGTGTAGTGGCACATGG - Intergenic
1172400540 20:34647405-34647427 TAGCCAGGTGTGGTGGCGCGCGG - Intronic
1172473772 20:35221769-35221791 TAGCTGGGAGTTGTGGCACATGG - Intergenic
1172838603 20:37888549-37888571 TGGCCAGGACATGTGGACCCTGG - Intergenic
1173541404 20:43854428-43854450 TAGCCAGGTGTGGTGGCACATGG - Intergenic
1173653571 20:44683431-44683453 TGGGCAGGAGTTCTGGCCTCTGG - Intergenic
1173804264 20:45913586-45913608 TAGCCAGGTGTGGTGGCACATGG - Intergenic
1173876324 20:46374484-46374506 AAGGCAGGAGATGTGGCACCAGG + Intronic
1173899205 20:46574925-46574947 TAGCCAGGTGTGGTGGTCCTAGG - Intronic
1174579205 20:51559107-51559129 TAGCCAGGAGGAGGGGTCCCTGG + Intronic
1175204994 20:57304482-57304504 TAGCCAGGAGATCTGGTCACAGG - Intergenic
1175207914 20:57326190-57326212 TAGCCAGGTGTGGTGGCCTGAGG - Intergenic
1175333566 20:58180453-58180475 TAGCCAGGTGTGGTGGCCCACGG + Intergenic
1175744425 20:61445363-61445385 AAGGCATGAGTTGTTGCCCCAGG + Intronic
1175898400 20:62350345-62350367 TTGCCAGGAGCTGTGGGCCCTGG - Intronic
1176713143 21:10325692-10325714 TAGCCAGGCGTGGTGGCAGCTGG - Intergenic
1177145685 21:17404550-17404572 TAGCCAGGCGTGGTGGCGCATGG + Intergenic
1177441713 21:21134857-21134879 TAGCCAGGTGTGGTGGCACGTGG - Intronic
1177505372 21:22012787-22012809 TAGCCAGGATTCATGGGCCCAGG - Intergenic
1179151554 21:38813230-38813252 TAGCCAGAAGTTCTGGACCTGGG + Intronic
1180631114 22:17230743-17230765 TAGCCAGGCGTGGTGGCGCATGG - Intergenic
1180829418 22:18893975-18893997 TAGCCAGGCATGGTGGCACCTGG - Intergenic
1180942811 22:19670674-19670696 TAGCCAGGTGTGGTAGCACCGGG + Intergenic
1181563004 22:23716662-23716684 TAGCCAGGCATGGTGGTCCCAGG + Intergenic
1182127632 22:27827721-27827743 CAGCCAGGAGACGGGGCCCCTGG + Intergenic
1182659275 22:31913822-31913844 TAGCCAGGCATGGTGGCTCCAGG - Intergenic
1183618983 22:38961830-38961852 AGGCCAGGAGATGTGGGCCCAGG + Intronic
1183897090 22:40978043-40978065 TAGCCAGGCGTGGTGGCGGCAGG + Intergenic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
1185293513 22:50040997-50041019 GAGCCAGGAGCTCTGGGCCCAGG + Intronic
1203279508 22_KI270734v1_random:119280-119302 TAGCCAGGCATGGTGGCACCTGG - Intergenic
949960688 3:9309578-9309600 TAGCCAGGTGTGGTGGCTCAGGG + Intronic
950367426 3:12497431-12497453 TGGCAAGGAGTGGTGGCACCAGG + Intronic
951681365 3:25298326-25298348 TAGCCAGGCGTGGTGGCACGTGG - Intronic
952037439 3:29219881-29219903 TAGCCAGGCGTGGTGGCCCATGG + Intergenic
952093500 3:29920827-29920849 TAGCCAGGTGTGGTGGCACGTGG + Intronic
952421242 3:33132930-33132952 TAGCCAGGCGTGGTGGCACGTGG + Intronic
954267753 3:49483348-49483370 TAGCCAGGTGTGGTGGCGCATGG - Intronic
954347529 3:50012886-50012908 TAGCCAGGCGTGGTGGCGCATGG - Intronic
954418201 3:50404477-50404499 CAGCCAGGAGCTGAGTCCCCAGG + Intronic
956968740 3:74495939-74495961 TAGAAAAGAGTTGTGGGCCCAGG + Intronic
957170250 3:76729781-76729803 TAGCCAGGCGTGGTGGCACGTGG - Intronic
957287194 3:78231789-78231811 TAGCCAGTAACTGTGGACCCAGG + Intergenic
958017937 3:87964461-87964483 GAGTCAGGAGTTGTGGCTCAGGG - Intergenic
960905725 3:122599220-122599242 TAGCCAGGTGTAGTGGCACATGG + Intronic
961550552 3:127668458-127668480 GGGCCAGGAGCTGTGGCCCCCGG - Exonic
962430267 3:135312468-135312490 GAGCCAGGACTAGTGGCCCATGG - Intergenic
963734851 3:149008162-149008184 AAGCCAACAGTTGTGGGCCCTGG + Intronic
967589724 3:191259323-191259345 TAGCCAGGAGCTACGCCCCCTGG + Intronic
968524521 4:1049209-1049231 GAGCCAGGATCTGTGGCCACAGG - Intergenic
968643071 4:1724537-1724559 TAGCCGGGAGTGGTGGCGGCGGG - Intronic
968681774 4:1925946-1925968 TAGCCAGGCGTGGTGGCACATGG - Intronic
968871178 4:3243339-3243361 TGGCCAGCAGCTGTGGTCCCGGG - Exonic
969108167 4:4823692-4823714 CAGTCAGGAGGTGTGGGCCCTGG - Intergenic
969112560 4:4852827-4852849 GACCCAGGAGCAGTGGCCCCAGG - Intergenic
970894576 4:21087320-21087342 TAGCCAGGTGTGGTGGCACATGG - Intronic
971079255 4:23190583-23190605 TAGCCAGGTGTGGTGGCGCATGG + Intergenic
972201104 4:36715752-36715774 TAGCCAGGATTTATGGGTCCAGG - Intergenic
972292377 4:37701741-37701763 TAGCCAGGTGTGGTGGCGCACGG - Intergenic
972496681 4:39640832-39640854 TAGCCAGGCGTGGTGGCGGCGGG - Intergenic
972591324 4:40490627-40490649 TAGCCGGGCGTGGTGGCGCCTGG + Intronic
974478861 4:62419456-62419478 TAGCCAGGATTCGTGGGTCCAGG - Intergenic
974611471 4:64223878-64223900 TAGACAGGCGTGGTGGCCCATGG - Intergenic
977089300 4:92650794-92650816 TAGCCAGGATTTATGGGTCCAGG - Intronic
980934892 4:139217084-139217106 TAGCCAGGCGTGGTGGCACATGG + Intergenic
981052089 4:140319235-140319257 TAGCCAGGCGTGGTGGCGCATGG - Intronic
981929783 4:150176791-150176813 TTGCCCAGACTTGTGGCCCCAGG + Intronic
984496753 4:180507475-180507497 TAGCTGGGAGTGGTGGCCCGTGG + Intergenic
984968671 4:185166324-185166346 TACACTGGAGATGTGGCCCCAGG - Intronic
985512799 5:321745-321767 TGGCCAGGAGCTGTGGCGGCGGG - Intronic
985711636 5:1432796-1432818 TGTCCAGGAGTTGTGGGCTCAGG - Intronic
986040516 5:3989655-3989677 TAGCCAGGTGTGGTGGCGCATGG - Intergenic
987391619 5:17381531-17381553 TAGCCAGGTGTGGTGGCACATGG + Intergenic
988215033 5:28261008-28261030 TAGCCAGGCGTGGTGGCACATGG - Intergenic
988474660 5:31573097-31573119 TAGCCAGGTGTGGTGGCACACGG + Intergenic
988980854 5:36567625-36567647 AAGCCAGGAGTGGTGGCTCAAGG + Intergenic
989496805 5:42118161-42118183 TAGCTTGAAGATGTGGCCCCTGG + Intergenic
989559582 5:42836009-42836031 CAGCCCAGAGTTGAGGCCCCAGG + Intronic
990577743 5:57139483-57139505 TAGCCAGGCGTGGTGGCGCATGG - Intergenic
992262728 5:74987169-74987191 TAGCCAGGTGTGGTGGCACATGG - Intergenic
993320021 5:86460006-86460028 TAGCCAGGATTTATGGGTCCAGG + Intergenic
994899780 5:105757059-105757081 TAGACAGGTGTGGTGGCACCTGG + Intergenic
995104231 5:108355426-108355448 TAGCCAGGTGTGGTGGCGCACGG - Intronic
997951656 5:138247304-138247326 TAGCCAGGTGTGGTGGCCCAGGG + Intergenic
997961188 5:138323075-138323097 TAGCCAGGCGTGGTGGCACCTGG - Intronic
998363415 5:141611128-141611150 TAGCCAGGCATGGTGGTCCCAGG + Intronic
1000917699 5:167102078-167102100 TAGCCAGGTGTGGTGGCACGTGG + Intergenic
1001083236 5:168682075-168682097 TGGCCAGGACCTGTGGCTCCAGG + Intronic
1001589706 5:172856970-172856992 TAGCCAAGGGTTGGGGCCCCTGG + Intronic
1002393697 5:178936941-178936963 CAGCCAGGCCTTGTGGCACCTGG + Intergenic
1003604129 6:7543230-7543252 TTACCAGGCGTTGTGGCCCTAGG + Intronic
1003659931 6:8050746-8050768 TAGCCAGGCATTGTGGCACTTGG - Intronic
1004211301 6:13648291-13648313 TAGCCAGGAGTGGTGGCATGTGG - Intronic
1004334875 6:14755648-14755670 TAGCCAGGCGTGGTGGCCTGTGG + Intergenic
1004638744 6:17493821-17493843 TACTCATCAGTTGTGGCCCCTGG + Intronic
1006771801 6:36559958-36559980 TAGCCAGGTGTGGTGGCACACGG - Intergenic
1006821540 6:36900345-36900367 TAGCCAGGTGTGGTGGCACATGG - Intronic
1007005828 6:38361401-38361423 TAGCTAGGAGTGGTGGCACATGG + Intronic
1007403616 6:41619080-41619102 TACCCATGTGTTCTGGCCCCAGG - Intergenic
1007538827 6:42622162-42622184 TAGCCAGGCGTGGTGGCAGCAGG - Intronic
1007599908 6:43075367-43075389 CAGCCAGGAGAAGTGGCGCCAGG - Intergenic
1007770379 6:44187186-44187208 TAGCCAGGCGTGGTGGCACACGG + Intergenic
1008102431 6:47406306-47406328 TAGCCAGGTGTGGTGGCACATGG + Intergenic
1008996438 6:57665276-57665298 TAGCCAGGATTTATGGGTCCGGG + Intergenic
1009417034 6:63427188-63427210 TAGCCAGGTGTGGTGGCACATGG - Intergenic
1011616841 6:89205219-89205241 GAGCCAGGGGTTCTGGCTCCAGG + Intronic
1011643369 6:89434578-89434600 TAGCCAGGTGTGGTGGTCCCAGG - Intronic
1011689377 6:89852340-89852362 TAGCCAGGTGTGGTGGCACATGG - Intronic
1017016593 6:150106069-150106091 TAGCCAGGTGTGGTGGCACGTGG + Intergenic
1017487732 6:154918604-154918626 TAGCCAGGCGTTGTGGCCCACGG - Intronic
1018059441 6:160079048-160079070 GAGCCTGGAGTTTTGGGCCCAGG + Intronic
1018404577 6:163465346-163465368 CAGCCAGGAGTGGTGGCTCATGG + Intronic
1019988624 7:4676761-4676783 TAGCCAGGTGTGGTGGCGCATGG - Intergenic
1021177578 7:17467974-17467996 TAGCCTGGTGTGGTGGCACCCGG - Intergenic
1022631957 7:32093793-32093815 CAGCGAGGGGTTCTGGCCCCTGG - Intronic
1022991005 7:35707222-35707244 TAGCCAGGCGTGGTGGCTCATGG - Intergenic
1024975781 7:55112537-55112559 TAGACAGGAAGTGTGGCCCGAGG + Intronic
1026586198 7:71658048-71658070 TAGCCAGGTGTGGTGGCACATGG - Intronic
1026796988 7:73372437-73372459 TAGCCAGGCGTGGTGGCACGTGG - Intergenic
1027720137 7:81730304-81730326 TAGCCAGGAGTGGTGGTGGCAGG + Intronic
1027982789 7:85248451-85248473 GATCCAGCAGTTGTGGTCCCTGG + Intergenic
1028298898 7:89171578-89171600 TAGCCAGGTGTGGTGGCACAAGG - Intronic
1029016355 7:97318864-97318886 TAGCCAGGAGTGGTGGCGGGTGG - Intergenic
1031653722 7:124325021-124325043 TAGCCAGGTGTGGTGGCACACGG + Intergenic
1031805216 7:126299708-126299730 TAGCCTGGTGTTGTGGCACATGG - Intergenic
1031878771 7:127172560-127172582 TAGCCAGGTGTGGTGGCACATGG + Intronic
1032018377 7:128393586-128393608 TAACCATGAGATGTGGACCCTGG - Intronic
1032829804 7:135611153-135611175 TATCCAGGCGTGGTGGCCCAGGG - Intronic
1033290275 7:140077409-140077431 CAGACAGGAGCTGTGGCCTCTGG - Intergenic
1033502553 7:141966342-141966364 TGGCCAGAAGTTCTGGCCTCTGG + Intronic
1034030293 7:147755105-147755127 TAGCAGGGAGTTGTGACCTCAGG + Intronic
1034391543 7:150791461-150791483 GAGCCAGGAGTGGGGGCCCTGGG + Exonic
1035283511 7:157792359-157792381 GACCCAGGAGAGGTGGCCCCGGG - Intronic
1035344852 7:158191247-158191269 TCACCAGGAGCTGTGGCCCTGGG - Intronic
1035346237 7:158201181-158201203 TAGCCAGGTGTGGTGGCGCCTGG - Intronic
1037129653 8:15391969-15391991 TAGCCAGGAGTGGTGGCTAATGG - Intergenic
1037489852 8:19387677-19387699 AAGCCAGGCACTGTGGCCCCAGG - Intronic
1037879229 8:22565107-22565129 CTGCCAGGAGGTGTGGCCCAGGG - Intronic
1038403532 8:27304946-27304968 CAGCCAAGAGTTCTGGCACCTGG + Intronic
1039098303 8:33911521-33911543 TAGCCAGGTGTGGTGGCACACGG + Intergenic
1039311417 8:36321649-36321671 TAGCCAGGGGTGGTGGCGGCGGG + Intergenic
1039486636 8:37915302-37915324 TAGCCATGACTTTGGGCCCCTGG - Intergenic
1039489519 8:37937093-37937115 CACCCAGGAGTGGCGGCCCCAGG + Intronic
1039558939 8:38497220-38497242 TAGCCAGGTGTGGTGGCTCGTGG - Intergenic
1039582648 8:38679611-38679633 TAGCCAGGTGTGGTGGCGCATGG + Intergenic
1039822049 8:41142952-41142974 AAGGCAGGAGATGTCGCCCCTGG + Intergenic
1041054414 8:53968694-53968716 TAGCCAGGCATGGTGGTCCCAGG + Intronic
1041669756 8:60480291-60480313 TAGCCAACAGTTGTGGCACTTGG - Intergenic
1042365825 8:67935298-67935320 TAGCCAGGTGTGGTGGCGCATGG - Intergenic
1042893571 8:73641200-73641222 TAGCCAGGCATAGTGGCCCTTGG + Intronic
1045344255 8:101280460-101280482 TGACCAGGAGTTGTGGGACCTGG - Intergenic
1045913931 8:107443671-107443693 TAGCCAGGTGTGGTGGCGCATGG + Intronic
1047342844 8:123999515-123999537 TAGCCAGGTGTGGTGGCACATGG + Intronic
1048178238 8:132171876-132171898 TAGGCATGAGTTGTGGCACGTGG - Intronic
1048341929 8:133546851-133546873 TAGCCAGGTGTGGTGGCACATGG + Intronic
1048996550 8:139797538-139797560 TAGCCAGGTGCTGTGGCTCATGG - Intronic
1049031681 8:140042875-140042897 GAGCCAGCAGTTGTGCCTCCGGG + Intronic
1049133521 8:140872059-140872081 TAGCCAGGTGTTGTGGCGTAAGG + Intronic
1049151878 8:141040382-141040404 GAGCCTGGAGTTTTGCCCCCAGG + Intergenic
1049175182 8:141188078-141188100 CAGCCAGGCGTGGTGGCCCATGG + Intronic
1049691658 8:143963786-143963808 TAGCCAGGTGTGGTGGCACATGG - Intronic
1049947574 9:612218-612240 AAGCCAGGTGTTGTGGCTCTTGG + Intronic
1050046709 9:1553826-1553848 TAACCAGGAGCTGTGATCCCAGG - Intergenic
1050104596 9:2152405-2152427 TAGCCAGGTGTGGTGGCTCATGG + Intronic
1050197696 9:3105855-3105877 TAGCCAGGCGTGGTGGCACATGG + Intergenic
1060799022 9:126532105-126532127 TAGCCAGGACTCCTGCCCCCTGG + Intergenic
1060811353 9:126613008-126613030 TAGGAGGGAGTGGTGGCCCCAGG - Intergenic
1061415269 9:130444175-130444197 CAGCTGGGAGTTGTGACCCCAGG - Intergenic
1061500753 9:131000537-131000559 TAGCCAGGCGTGGTGGCACGTGG - Intergenic
1061693989 9:132357086-132357108 TAGCCAGGCGTGGTGGCACGTGG - Intergenic
1062135717 9:134926757-134926779 TAGCCAGGATTCATGGCTCCAGG + Intergenic
1185479553 X:435774-435796 TGGGCAGGAGCGGTGGCCCCAGG + Intergenic
1186425038 X:9457376-9457398 TAGCCAGGCGTGGTGGCACGTGG + Intergenic
1186443551 X:9606532-9606554 TAGCCAGGTGTGGTGGCGCATGG + Intronic
1187176324 X:16899175-16899197 TAGCCAGGTGTTGTGGCAGGTGG - Intergenic
1188441759 X:30220493-30220515 TAGCCAGGCGTGGTGGCGCATGG + Intergenic
1189771054 X:44427764-44427786 TAGCCAGGCGTGGTGGCGCATGG + Intergenic
1190863378 X:54364047-54364069 TAGCCAGGTGTAGTGGCGCGCGG + Intergenic
1192475565 X:71438817-71438839 TAGCCAGGCGTGGTGGCACGTGG + Intronic
1192744947 X:73929615-73929637 TAGCCGGGAGTGGTGGCACATGG - Intergenic
1194016338 X:88625649-88625671 TAGCCAGGAGTGGTTGCAGCAGG + Intergenic
1194779208 X:98002807-98002829 TTGCCAGGAGTTGGAGTCCCAGG + Intergenic
1196072212 X:111538720-111538742 TAGCCAGGCGTGGTGGCACAAGG + Intergenic
1197271957 X:124434370-124434392 TGGACAGGACTTATGGCCCCAGG - Intronic
1197355918 X:125437399-125437421 GAGCCAGGAGTTTGAGCCCCAGG + Intergenic
1197794197 X:130282971-130282993 AAGGCACCAGTTGTGGCCCCTGG + Intergenic
1198487155 X:137098896-137098918 TAGCCAGGACCTGTAGTCCCAGG - Intergenic
1199144268 X:144347544-144347566 TAGCCAGGAGTTATGGTTCCAGG - Intergenic
1199569642 X:149254638-149254660 CAGCCAGGAGTCTTGGCTCCAGG - Intergenic
1200756583 Y:6995729-6995751 TAGCCAGGAGTGGTAGCACACGG - Intronic
1201057954 Y:10014759-10014781 TGGCCAGGCGTGGTGGCCCATGG + Intergenic
1202199213 Y:22329323-22329345 TAGCCAGGCTTGGTGGCCCATGG - Intronic