ID: 1070596914

View in Genome Browser
Species Human (GRCh38)
Location 10:77838816-77838838
Sequence CGGCAAGAGCAGACCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070596914_1070596922 23 Left 1070596914 10:77838816-77838838 CCCCTCCTGGTCTGCTCTTGCCG 0: 1
1: 0
2: 0
3: 30
4: 328
Right 1070596922 10:77838862-77838884 GAAGCCAGACCAACTTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070596914 Original CRISPR CGGCAAGAGCAGACCAGGAG GGG (reversed) Intronic
900090311 1:917354-917376 AGGCAAGACCAGAAAAGGAGGGG - Intergenic
900435765 1:2629823-2629845 CAGCATGAGCAGCCCAGGGGGGG - Intronic
900564501 1:3325705-3325727 CAGCAACACCAGACCTGGAGAGG - Intronic
900581815 1:3413244-3413266 GGGCAGGAGCGCACCAGGAGGGG - Intronic
901065932 1:6494657-6494679 AGGCAAGGGCAGTCCAGGAAGGG - Intronic
901144159 1:7053944-7053966 GGGCAAGGGCAGGCCAGGATGGG - Intronic
901649996 1:10737827-10737849 CAGGAAGAGCAGGCCTGGAGTGG - Intronic
901729284 1:11267188-11267210 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
902096568 1:13950654-13950676 AGGCCTGAGCAGACCAGGAGAGG + Intergenic
902406037 1:16184209-16184231 CAGCAAGAGAAGACCTGGATTGG - Intergenic
902800469 1:18826457-18826479 GGTGAAGAGCAGGCCAGGAGTGG + Intergenic
904584038 1:31569251-31569273 TGGCAGGAGCAGACCTGCAGAGG - Intergenic
904809268 1:33152849-33152871 CGGGGAGAGCAGCCCAGGATGGG + Intronic
904832581 1:33314596-33314618 CAGCAGGTGCAGAGCAGGAGGGG - Intronic
905897563 1:41558571-41558593 CCCCAAGAGCAGGCCAGGAGGGG - Intronic
907275500 1:53314633-53314655 CAGGAAGAGCAGTCCAGGGGCGG + Intronic
907319046 1:53591306-53591328 AGGCAAGAGGAGGCCAGGGGAGG + Intronic
908961404 1:69700669-69700691 GGGGAAGAGAAGACCAAGAGAGG + Intronic
909100568 1:71343183-71343205 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
910195873 1:84638980-84639002 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
913663039 1:121021510-121021532 CGGCAAGAGGAGCCAAAGAGAGG + Intergenic
914014422 1:143804775-143804797 CGGCAAGAGGAGCCAAAGAGAGG + Intergenic
914163397 1:145156426-145156448 CGGCAAGAGGAGCCAAAGAGAGG - Intergenic
914653046 1:149713332-149713354 CGGCAAGAGGAGCCAAAGAGAGG + Intergenic
914993832 1:152522026-152522048 GGGCAGGAGCTGACCAAGAGTGG - Intronic
915578153 1:156795103-156795125 CGGCAAGAGTAGAGCAGCTGTGG - Intronic
915626632 1:157117913-157117935 TGGCAAGAACACAGCAGGAGGGG - Intergenic
916314744 1:163436778-163436800 GGGCAAGGGCAGCCCAGGGGTGG - Intergenic
917098725 1:171425254-171425276 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
918324469 1:183396238-183396260 AGGCATGAGCAGGGCAGGAGAGG + Intronic
918585004 1:186176876-186176898 AGGAAAGAGCAGGCCAGGTGTGG + Intronic
918967599 1:191372158-191372180 AGGCACGAGCAGGACAGGAGAGG - Intergenic
922718695 1:227889527-227889549 GGGGAGGGGCAGACCAGGAGGGG - Intergenic
922875319 1:228935843-228935865 AGGCATGAGCAGGGCAGGAGGGG + Intergenic
922883462 1:229000316-229000338 AGGCATGAGCAGGACAGGAGGGG + Intergenic
923888027 1:238179881-238179903 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1063339757 10:5252304-5252326 GGGCTACAGCAGAGCAGGAGAGG - Intergenic
1063343970 10:5294346-5294368 GGGCTACAGCAGAGCAGGAGAGG + Intergenic
1064036682 10:11919337-11919359 TGGCAAGAGATGACCAAGAGTGG + Intergenic
1064775892 10:18777103-18777125 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1065506428 10:26434509-26434531 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1065506717 10:26437057-26437079 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1065534927 10:26707456-26707478 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1065794605 10:29294278-29294300 CTGCAAGAGGAAACCAAGAGAGG + Intronic
1066083181 10:31952575-31952597 AGGCATGAGCAGAGCAGGAAAGG - Intergenic
1066084491 10:31963071-31963093 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
1066662836 10:37753348-37753370 CCCCAAGAGAAGAGCAGGAGTGG - Intergenic
1067460074 10:46451683-46451705 CAGCCAGAACAGACCAAGAGAGG - Intergenic
1067512213 10:46905547-46905569 AGGCAGGAGCAGAGCAGGAGAGG + Intergenic
1067627116 10:47932930-47932952 CAGCCAGAACAGACCAAGAGAGG + Intergenic
1067650031 10:48146275-48146297 AGGCAGGAGCAGAGCAGGAGAGG - Intergenic
1069637035 10:69931196-69931218 TGGCCAGAGCAGACCCAGAGTGG + Intronic
1069693410 10:70369443-70369465 CTGCAAAAGCAAAGCAGGAGAGG + Intronic
1070596914 10:77838816-77838838 CGGCAAGAGCAGACCAGGAGGGG - Intronic
1070847376 10:79534319-79534341 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1070926421 10:80225973-80225995 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1071392958 10:85193895-85193917 TGGGAAGAGCAAACCATGAGAGG - Intergenic
1072519997 10:96222865-96222887 AGGCATGAGCAGGGCAGGAGAGG + Intronic
1072531281 10:96321790-96321812 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1072709145 10:97704465-97704487 CAGCCAGAGCACAGCAGGAGGGG + Intergenic
1074002564 10:109387495-109387517 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1074407231 10:113189978-113190000 TGGGAAGAGCATGCCAGGAGAGG - Intergenic
1076783357 10:132736656-132736678 CGGCAAGAGCAGCCAAGGCCAGG + Intronic
1078022070 11:7664656-7664678 CGGCAGGAGCAAACCAAGAAGGG + Intergenic
1078896709 11:15603431-15603453 TGGCAAGAGCAGAGCAGGATTGG + Intergenic
1079589753 11:22167736-22167758 AGGCATGAACAGAGCAGGAGAGG - Intergenic
1080573256 11:33576234-33576256 AGACAAGAGCTGAGCAGGAGAGG - Intronic
1080683463 11:34496481-34496503 CTGAAAGAGAAGAGCAGGAGAGG - Intronic
1082192713 11:49266798-49266820 AGGCAAGAGCATGGCAGGAGAGG + Intergenic
1083380673 11:62265811-62265833 AGGCAAGGGCAGAGGAGGAGGGG + Intergenic
1083511140 11:63210400-63210422 GGGGAAGACAAGACCAGGAGAGG + Intronic
1083849050 11:65354871-65354893 CGGCGACAGCAGAACAGGGGAGG - Exonic
1084093454 11:66894497-66894519 CCCCAAGGGCAGAACAGGAGAGG + Intronic
1084375437 11:68773643-68773665 TGACATGAGCAGGCCAGGAGAGG + Intronic
1084666625 11:70579829-70579851 CGGGAGGAGCAGAGCTGGAGAGG + Intronic
1085301774 11:75462890-75462912 CTGGAAGAGCAGAGGAGGAGGGG + Intronic
1086390136 11:86355411-86355433 AGGCATGAGCAGGTCAGGAGAGG + Intergenic
1087066511 11:94032622-94032644 AGGCATGAGCAGGGCAGGAGAGG + Intronic
1087978694 11:104583861-104583883 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1091253389 11:134163008-134163030 AGGCAAGAGCACACGAGTAGGGG + Intronic
1091552619 12:1548312-1548334 AAGAAAGTGCAGACCAGGAGAGG - Intronic
1091843731 12:3638565-3638587 GGACAAGAGCAGTCCGGGAGAGG + Intronic
1094692072 12:32779416-32779438 GGGCAGGAGCAGGGCAGGAGAGG + Intergenic
1095552234 12:43456649-43456671 TGGCAAGAGCACACCTGGACAGG + Intronic
1095818234 12:46448462-46448484 CGGGAAGAGAAGATCAGCAGGGG + Intergenic
1096131221 12:49160431-49160453 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096472044 12:51885058-51885080 TGGCAAGAGCACACCTGGACAGG - Intergenic
1098055679 12:66502952-66502974 AGGCATGAGCAGGGCAGGAGAGG + Intronic
1099321978 12:81162257-81162279 AGGCAAGAGGAGACCTGGAGAGG + Intronic
1099437503 12:82661183-82661205 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
1099687722 12:85910745-85910767 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1101778893 12:107817960-107817982 TGGCAAGAGCACACCTGGACAGG + Intergenic
1103161431 12:118732525-118732547 TGGCATGAGCAGGGCAGGAGAGG + Intergenic
1104557663 12:129816065-129816087 AGGCAAGTGCACACCATGAGCGG - Intronic
1104816266 12:131647295-131647317 CGGCAAGAGCCGGCCAGAGGCGG - Intergenic
1107790374 13:43995890-43995912 AGACATGAGCAGATCAGGAGAGG - Intergenic
1110609977 13:77476627-77476649 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
1115023318 14:28709967-28709989 TGGCAAGACTAGACCAGCAGAGG + Intergenic
1115284671 14:31703995-31704017 CGGCATGAGCAAGGCAGGAGAGG - Intronic
1116966612 14:51021730-51021752 TGGGAAGAGCAAACCAGAAGGGG - Intronic
1117528115 14:56631972-56631994 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1121044210 14:90776108-90776130 AGGCATGAGCAGGGCAGGAGAGG + Intronic
1121814729 14:96920502-96920524 AGACAAGAGCAGCCAAGGAGAGG - Intronic
1121815049 14:96922849-96922871 CGTGATGAGCAGAGCAGGAGAGG + Intronic
1122153171 14:99735446-99735468 CAGCAAGAGCCAACCAAGAGGGG + Intergenic
1122882296 14:104695557-104695579 CGGCAAGCGCAGCCCAGGCAAGG - Intronic
1124078551 15:26469871-26469893 AGACATGAGCAGAGCAGGAGAGG + Intergenic
1125882595 15:43207395-43207417 CGGTCAGAGCAGTCAAGGAGGGG - Exonic
1126567405 15:50114466-50114488 CAGCAAGAGCAGACTAGGAAAGG - Intronic
1128668741 15:69558520-69558542 AGCCAGGAGCAGAGCAGGAGAGG + Intergenic
1133175492 16:4011133-4011155 CGGCAATAGCAAACCAGGCCAGG + Intronic
1133747980 16:8701912-8701934 TGGCTGGAGCAGAGCAGGAGGGG + Intronic
1135474630 16:22763300-22763322 GGGCTGGAGCTGACCAGGAGAGG + Intergenic
1135588594 16:23689837-23689859 CTGCAAGAGAAGAGCAGCAGGGG - Intronic
1135789057 16:25376669-25376691 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1136184028 16:28574575-28574597 AGGCAGGAGCAGGGCAGGAGAGG - Intronic
1137244404 16:46690292-46690314 TGGCAAGAGCAGCCCAGGCAGGG + Intronic
1137675564 16:50302138-50302160 GGGCAGGAGGAGACCAGGTGGGG - Intronic
1138727123 16:59152238-59152260 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1138743267 16:59334682-59334704 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1138748375 16:59389777-59389799 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1141513785 16:84529443-84529465 GGGCAAGACCAGCTCAGGAGGGG + Intronic
1141681909 16:85549786-85549808 GGGCAAGGGCATACAAGGAGAGG - Intergenic
1141882198 16:86867509-86867531 GGGGAAGAGCATGCCAGGAGAGG - Intergenic
1142517333 17:441238-441260 CGGCAAGCTCAGACCACGGGTGG + Exonic
1143582030 17:7833306-7833328 GGGCAGGAGCAGGGCAGGAGCGG - Intronic
1144214959 17:13047210-13047232 CAGGAAGAGCAGAGCAGGAGAGG - Intergenic
1146464512 17:33075622-33075644 CAGAAGGAGCAGACCAGCAGGGG - Intronic
1148672848 17:49425011-49425033 CAGCAAGAGCAGGCCAGGCATGG - Intronic
1148925457 17:51080952-51080974 GAGCTAGAGAAGACCAGGAGAGG - Intronic
1152290626 17:79437869-79437891 CTTCATGAGCAGACCTGGAGAGG + Intronic
1152820567 17:82435731-82435753 CAGCAAGAGCAGAACAGCACGGG + Exonic
1153059785 18:983071-983093 GGGCAGGAGCAGACCAGGCTTGG - Intergenic
1155149455 18:23111449-23111471 AGGGAACTGCAGACCAGGAGTGG + Intergenic
1155797527 18:30059190-30059212 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1156644222 18:39140557-39140579 CAGCATGAGCAGGGCAGGAGAGG + Intergenic
1157523557 18:48361913-48361935 CGGCAGGAGGAGACAATGAGGGG + Intronic
1158812982 18:61059037-61059059 AGGCATGAGCAGGTCAGGAGAGG - Intergenic
1159067713 18:63588476-63588498 CAGCAAGAGAAGGCCAAGAGAGG + Intronic
1159892812 18:73968537-73968559 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1160303151 18:77704745-77704767 CAACAAGAGCACACCCGGAGGGG - Intergenic
1161740602 19:6018821-6018843 CTGCAGGAGCAGAGCTGGAGGGG - Intronic
1162300574 19:9842631-9842653 AGGCAGGAGGATACCAGGAGAGG - Intronic
1165480920 19:36063652-36063674 TGGCAGGAACAGACCAGAAGGGG + Intronic
925977123 2:9149418-9149440 CGGGAAGAGCAACCCAGGACAGG + Intergenic
926967329 2:18429482-18429504 AGACATGAGCAGAGCAGGAGAGG + Intergenic
926990812 2:18677660-18677682 CTTCATGGGCAGACCAGGAGAGG - Intergenic
927642684 2:24855429-24855451 CGGGAAGAGCCGAGCAGGGGTGG + Intronic
927927279 2:27022861-27022883 GGGAAAGAGAAGAGCAGGAGAGG + Intronic
928256921 2:29730762-29730784 AGGCTAGGCCAGACCAGGAGTGG - Intronic
928275058 2:29893078-29893100 CGACAACAGCACATCAGGAGTGG - Intronic
928854892 2:35791258-35791280 AGGTATGAGCAGAGCAGGAGAGG + Intergenic
929710713 2:44263692-44263714 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
930024608 2:47022495-47022517 TGGCAAGAGAAGGCCAGGTGTGG - Intronic
931884958 2:66607301-66607323 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
935261520 2:101359648-101359670 AGACATGAGCAGGCCAGGAGAGG - Intronic
936085374 2:109463959-109463981 TGGCAAGAGGTCACCAGGAGAGG + Intronic
936445610 2:112592309-112592331 GGGCAAGAGCAGACCAGTTCAGG - Intergenic
937328215 2:121004963-121004985 AGGCAATAGGAGACCAGGATGGG - Intergenic
938085408 2:128396646-128396668 GGGCAGGAACAGACCAAGAGGGG - Intergenic
939000346 2:136727633-136727655 GCCCAGGAGCAGACCAGGAGAGG - Intergenic
940857609 2:158741766-158741788 AGGCATGAGCCGAGCAGGAGAGG + Intergenic
943046654 2:182868102-182868124 TGGAAGAAGCAGACCAGGAGGGG - Intergenic
943249300 2:185496305-185496327 GGGCATGAGCGGGCCAGGAGAGG - Intergenic
943638598 2:190334125-190334147 AGGCAAGAGGAGACAAGAAGAGG - Intronic
943905086 2:193489503-193489525 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
944911401 2:204313891-204313913 CAGCAAAAGCAGTCCAAGAGAGG + Intergenic
944914436 2:204343820-204343842 AGGCAACAGCAGTGCAGGAGAGG + Intergenic
945150529 2:206785573-206785595 GGGCAAGAGAAGACCAGAGGGGG + Intronic
946216312 2:218186455-218186477 TTGCAAGACCAGTCCAGGAGAGG + Intergenic
947156970 2:227172320-227172342 AGGCATGAGCAGGGCAGGAGAGG - Intronic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948212555 2:236205359-236205381 GGGGAAGAGCAGCCCAGCAGAGG - Intronic
948342432 2:237265124-237265146 AGGCGAGAGGAGCCCAGGAGCGG - Intergenic
949018089 2:241724866-241724888 CGGCAGGAGGGCACCAGGAGAGG - Intronic
1169751570 20:8999968-8999990 AGACATGAGCAGAGCAGGAGAGG + Intergenic
1173880651 20:46409423-46409445 GGGGAAGAGCATTCCAGGAGAGG - Intronic
1174054773 20:47790715-47790737 CGGGAAGATCAGCCAAGGAGGGG - Intergenic
1174171564 20:48620993-48621015 CGGCAAGCCCAGCCCAGGAGAGG + Intergenic
1174188721 20:48724978-48725000 CAGCAGGAGCAGACCAGAGGAGG + Intronic
1174365787 20:50055373-50055395 CTGCAGGAGCAGTCCGGGAGGGG + Intergenic
1175349077 20:58305697-58305719 AGAAAAGAGCAGACCAGGCGCGG + Intergenic
1175437115 20:58961297-58961319 GGGGAGGAGCAGAGCAGGAGAGG - Intergenic
1176287323 21:5025005-5025027 CAGGAAGAGCAGTCCAGGACTGG - Exonic
1178479481 21:32967254-32967276 AGACATGAGCAGGCCAGGAGGGG + Intergenic
1179869858 21:44238470-44238492 CAGGAAGAGCAGTCCAGGACTGG + Exonic
1180786991 22:18553011-18553033 CGGTGAGAGCAGATCAGGAAGGG - Intergenic
1181234749 22:21442295-21442317 CGGTGAGAGCAGATCAGGAAGGG + Intronic
1181243901 22:21492536-21492558 CGGTGAGAGCAGATCAGGAAGGG - Intergenic
1182663779 22:31943447-31943469 CGCCAAGGGCAGTGCAGGAGAGG - Intronic
1183594046 22:38799083-38799105 CAGCAAGAGCAGCCCAAGAAAGG - Intergenic
1183685593 22:39359747-39359769 CGGGAAGAGGAGGCCAGGTGTGG - Intronic
1184226968 22:43134660-43134682 TGGCGAGCACAGACCAGGAGTGG + Intronic
1203280605 22_KI270734v1_random:128953-128975 CAGCAGGAGCAGACCAGGCCTGG - Intergenic
949965320 3:9351083-9351105 AGGCAAGAGCAGTCCAAGAGAGG + Intronic
950316406 3:12004970-12004992 CGGCAGCCGCAGGCCAGGAGAGG + Intronic
951097229 3:18646244-18646266 TGGCAAGAGAACACCAGGAATGG - Intergenic
951263484 3:20539897-20539919 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
952862152 3:37821885-37821907 CAGCACGATCAGACCAGCAGAGG - Exonic
953844536 3:46416929-46416951 CAGAAAGAGCAGGGCAGGAGAGG - Intergenic
954624595 3:52015692-52015714 CTGGAAGAGCTGAGCAGGAGGGG + Intergenic
955353938 3:58215146-58215168 GTGCAAGGGCAGACCAGTAGGGG - Intergenic
955632686 3:60991337-60991359 GGGCAGGAGCAGATCAGGTGGGG + Intronic
956034785 3:65079273-65079295 CCACAAGAGGAGACAAGGAGTGG - Intergenic
957189603 3:76990552-76990574 AGACATGAGCAGAGCAGGAGAGG + Intronic
958532380 3:95349983-95350005 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
958929888 3:100197693-100197715 AGGCAAGAGCAGGGCAGGAGAGG - Intergenic
960708607 3:120505467-120505489 AGACATGAGCAGAGCAGGAGAGG + Intergenic
961743087 3:129046217-129046239 GGGCCAGCGCAGACCAGGCGAGG - Intergenic
962014272 3:131424444-131424466 AGGCAAGAGGAGACCAGAATGGG - Intergenic
964862292 3:161216380-161216402 AGGCAAGAGCTGGACAGGAGAGG + Intronic
965299069 3:166987730-166987752 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
965585499 3:170314319-170314341 GGGCAAGAACAGAGCAGGATGGG - Intergenic
966821532 3:183928659-183928681 CGGCCAGAGCAGACGGGGTGTGG + Intronic
967974789 3:195027664-195027686 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
967988783 3:195115753-195115775 CGGCAGGTGCAGGCCAGGACCGG + Intronic
968643804 4:1728557-1728579 CGGTAGGAGCGGAGCAGGAGAGG + Exonic
969171651 4:5368769-5368791 AGGCAAGAGGACACCAGCAGTGG - Intronic
969248460 4:5951899-5951921 AGGGAAGAGCAGAGGAGGAGAGG - Intronic
969901556 4:10354958-10354980 AGGCATGAGCAGAGCAGGAGAGG + Intergenic
969992081 4:11275110-11275132 AGGCAAGAGGAGAACAGAAGTGG - Intergenic
971878092 4:32330149-32330171 AGGCATGAGCAGGACAGGAGAGG + Intergenic
972630338 4:40836613-40836635 GGGCAGGAGAAGCCCAGGAGAGG + Intronic
972865103 4:43222113-43222135 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
974203154 4:58666898-58666920 AGGCAAAAGGAAACCAGGAGTGG - Intergenic
974332594 4:60499378-60499400 AGGCATGAGCAGGACAGGAGAGG - Intergenic
974627832 4:64446574-64446596 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
975908580 4:79244259-79244281 AGGCATGAGCAGGGCAGGAGAGG - Intronic
977720808 4:100238369-100238391 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
979793458 4:124815127-124815149 AGACAAGAGCAGGGCAGGAGAGG + Intergenic
979919213 4:126477651-126477673 AGGCATGAGCGGAACAGGAGAGG - Intergenic
981191960 4:141874133-141874155 GGACATGAGCAGAGCAGGAGAGG - Intergenic
981450008 4:144885993-144886015 AGGCATGAGCAGGACAGGAGTGG + Intergenic
981526449 4:145710820-145710842 AGACATGAGCAGAACAGGAGAGG - Intronic
981636618 4:146888345-146888367 GGTAAAGAGCAGACCAGGTGGGG + Intronic
982889209 4:160825737-160825759 AGACATGAGCAGAGCAGGAGAGG + Intergenic
984329632 4:178298101-178298123 AGACATGAGCAGAGCAGGAGGGG - Intergenic
985490907 5:178330-178352 AGGCATGAGCAGGGCAGGAGAGG - Intronic
986650532 5:9959195-9959217 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
986748468 5:10763895-10763917 CGGCCTGAGCAGGGCAGGAGAGG + Intergenic
987572026 5:19676396-19676418 AGGCAGGAGCAGGGCAGGAGAGG + Intronic
988322368 5:29714852-29714874 CTGCAAGAGCTGACAAGAAGTGG - Intergenic
989776991 5:45220998-45221020 AGGCAAGTTCAGAGCAGGAGTGG + Intergenic
990896163 5:60701874-60701896 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
991540304 5:67720455-67720477 AGGGAAGAGGAGAGCAGGAGAGG - Intergenic
991657961 5:68921988-68922010 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
991995704 5:72384480-72384502 CGGGAAAAGGAGACCAGGTGAGG - Intergenic
992218506 5:74548395-74548417 GGGCATGAGGAGACCAGGGGTGG + Intergenic
993706806 5:91180480-91180502 TGCCAAGAACAGACCAGGCGCGG + Intergenic
995482805 5:112609701-112609723 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
996289417 5:121834552-121834574 AGGCATGAGCAGGACAGGAGAGG + Intergenic
998040023 5:138945918-138945940 CGGCAAGAGGCGAGCAGGAGAGG + Intergenic
1003151774 6:3558700-3558722 CGTCCAGAGGAGACCATGAGTGG - Intergenic
1004271035 6:14195758-14195780 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1004896054 6:20148794-20148816 CCACAAGAGCAAACCAAGAGGGG + Intronic
1006017865 6:31096822-31096844 AGGCACGAGCAGAGCAGGAGAGG + Intergenic
1006499785 6:34450809-34450831 CGGAAGGAGGAGGCCAGGAGAGG + Intergenic
1006608482 6:35277205-35277227 AGGTCAGAGCAGACCAAGAGAGG + Intronic
1006641364 6:35491389-35491411 AGGGAGGGGCAGACCAGGAGGGG + Intronic
1008804518 6:55411554-55411576 AGGCATGAGCAGGACAGGAGAGG + Intergenic
1009746299 6:67820981-67821003 AGACATGAGCAGAGCAGGAGAGG - Intergenic
1010222043 6:73456478-73456500 CTGCAAGAGCTGTCCAGGTGTGG + Intergenic
1012829459 6:104186973-104186995 CTTCATGGGCAGACCAGGAGGGG + Intergenic
1014463828 6:121730563-121730585 TGGCAAGAGCACACCTGGACAGG + Intergenic
1014738441 6:125121763-125121785 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1014768464 6:125434306-125434328 AGGCATGAGCAGGGCAGGAGGGG - Intergenic
1016466500 6:144330723-144330745 CAGACAGAGCAGACCAGGATTGG + Intronic
1017504279 6:155053443-155053465 CTGCAAGAATAGGCCAGGAGCGG - Intronic
1017599048 6:156060894-156060916 TGGCCAGAGAGGACCAGGAGAGG + Intergenic
1018629546 6:165810213-165810235 CAGCAAGGGCAGACCAAGGGTGG - Intronic
1018843003 6:167531995-167532017 CAGCAAGAGGAGACCGTGAGCGG + Intergenic
1018845916 6:167555368-167555390 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1018859137 6:167698461-167698483 AGGCAAGAGCAGGCGGGGAGAGG + Intergenic
1019329587 7:455900-455922 GGGAGAGACCAGACCAGGAGGGG + Intergenic
1019348671 7:543060-543082 AGGCAAGAGCGGCCCAAGAGGGG + Intergenic
1020538473 7:9430424-9430446 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1020573233 7:9892712-9892734 TGGCAAGAGTAGTCCAGGCGTGG + Intergenic
1021666018 7:22980985-22981007 GGGCAAGAGCCTTCCAGGAGAGG - Intronic
1022736373 7:33079953-33079975 AGACAAGAGCAGGGCAGGAGAGG - Intergenic
1022973731 7:35538739-35538761 AGGCAAGACCAGACCAGGAAGGG - Intergenic
1023089773 7:36607097-36607119 TGGCAAGAGCAGGAGAGGAGAGG + Intronic
1023615584 7:42016297-42016319 CTGCAAGAGAAGAACTGGAGCGG - Intronic
1025989684 7:66487137-66487159 AGTCAAGAGCTGACCAGGTGTGG + Intergenic
1026221333 7:68400103-68400125 TGGCATGAGCGGAGCAGGAGAGG - Intergenic
1026873254 7:73865889-73865911 AGGCTAGGCCAGACCAGGAGAGG - Exonic
1027212244 7:76159588-76159610 AGTCAAGAGCTGACCAGGTGTGG + Intergenic
1027596861 7:80184759-80184781 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1028342995 7:89746015-89746037 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1029271411 7:99379327-99379349 CTTCAAGAGCAGAGCTGGAGAGG + Intronic
1031220471 7:118958555-118958577 CAGTATGAGCAGACAAGGAGGGG - Intergenic
1031593315 7:123619821-123619843 GGGCAAGAGCAGGCAAGAAGGGG - Intronic
1031779860 7:125947479-125947501 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1031926418 7:127642863-127642885 AGTCAAGAGCAGGCCAGGTGCGG - Intergenic
1032485551 7:132284632-132284654 AGGCCAGAGCCAACCAGGAGTGG + Intronic
1033672758 7:143508914-143508936 TGGGAAGAGCATTCCAGGAGTGG + Intergenic
1034274316 7:149817426-149817448 GGGCATGAGCACACCATGAGAGG - Intergenic
1034445958 7:151114601-151114623 CGGCAAGCCCAGACCTGGAGAGG - Intronic
1034852454 7:154507645-154507667 AGGCAAGAGCAGGACTGGAGAGG + Intronic
1035945166 8:3954226-3954248 AGGCAAGTCCAGAGCAGGAGTGG + Intronic
1037020235 8:13960723-13960745 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1037943685 8:22973522-22973544 GGGGGAGAGCAGACCAGGTGTGG - Intronic
1038404866 8:27314019-27314041 AGGCATGAGCAGGGCAGGAGAGG - Intronic
1039055549 8:33533480-33533502 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1042064151 8:64855685-64855707 AGGAAAGAGAAGACCAGCAGAGG - Intergenic
1042863053 8:73333045-73333067 AGGCATGAGCAGAACAGGAGAGG + Intergenic
1043598359 8:81911332-81911354 TGGCAAGAGCATACCTGGACAGG + Intergenic
1044020477 8:87100033-87100055 AGGTAAGAGAATACCAGGAGAGG + Intronic
1044085449 8:87937198-87937220 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1044847620 8:96397756-96397778 CTGCCAGAACAGCCCAGGAGGGG + Intergenic
1045977794 8:108149174-108149196 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
1048128343 8:131662935-131662957 AGGCATGAGCAGGGCAGGAGTGG + Intergenic
1049312398 8:141940025-141940047 CGGCAAGAGGACACAGGGAGAGG + Intergenic
1049420248 8:142513263-142513285 CCGCAAGGGCAGACCATGTGTGG + Intronic
1049467206 8:142757022-142757044 CACCAAGAGCAGAGCAGGCGGGG - Intergenic
1051278829 9:15421793-15421815 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1051997241 9:23232909-23232931 AGGCATGAGCAGAGCAGGAGAGG + Intergenic
1053825771 9:42022820-42022842 AGACATGAGCAGAACAGGAGAGG + Intronic
1054604792 9:67164573-67164595 AGACATGAGCAGAACAGGAGAGG - Intergenic
1055019082 9:71649744-71649766 CGTCCAGACCAGACCAGGTGTGG + Intergenic
1055058658 9:72046830-72046852 AGACATGAGCAGAGCAGGAGAGG + Intergenic
1055726628 9:79237283-79237305 CAGCCTGAACAGACCAGGAGAGG - Intergenic
1057612967 9:96563042-96563064 CTGAAAGAGCAAACCAAGAGTGG + Intronic
1058527032 9:105869309-105869331 CAGCAAGAGCAGAGTAGAAGGGG - Intergenic
1059901367 9:118930138-118930160 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1060646669 9:125286432-125286454 GGTCAAGAGCTGGCCAGGAGTGG - Intronic
1060962837 9:127693354-127693376 CAGCAGGAGCAGAGGAGGAGAGG - Intronic
1061265708 9:129503777-129503799 CGGCAACTGCAGACAAGCAGAGG + Intergenic
1061276835 9:129573714-129573736 TGGGAAGAGCAAAACAGGAGCGG - Intergenic
1061554951 9:131361807-131361829 AGGCATGAGCACAGCAGGAGAGG - Intergenic
1061907360 9:133705482-133705504 GGGCAAGAGCAGATCAGGGCAGG - Intronic
1062359528 9:136180965-136180987 CTGGAAGGGCATACCAGGAGGGG + Intergenic
1185669460 X:1794709-1794731 AGGCAGGAGGGGACCAGGAGAGG + Intergenic
1185956726 X:4498844-4498866 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
1187613527 X:20968811-20968833 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1188953612 X:36407596-36407618 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1189492390 X:41480342-41480364 AGGCATGAGCAGAGCAGAAGAGG + Intergenic
1189674815 X:43451167-43451189 TGGCAAGAGCACACCTGGACAGG + Intergenic
1189674984 X:43452420-43452442 TGGCAAGAGCACACCTGGACAGG - Intergenic
1193330793 X:80233411-80233433 AGACATGAGCAGAGCAGGAGAGG - Intergenic
1193518657 X:82502504-82502526 AGGCAAGAGCAGATCACGAGGGG + Intergenic
1193956918 X:87874669-87874691 AGCCATGAGCAGAGCAGGAGAGG - Intergenic
1194010948 X:88560143-88560165 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1194169767 X:90566579-90566601 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
1194170728 X:90576860-90576882 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1194413521 X:93582097-93582119 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1194849660 X:98855530-98855552 AGACATGAGCAGAGCAGGAGAGG + Intergenic
1194980731 X:100437832-100437854 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1195258397 X:103110388-103110410 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1197492879 X:127140269-127140291 AGGCATGAGCAGGGCAGGAGAGG + Intergenic
1197894073 X:131292240-131292262 CGGCAAGACCTGATGAGGAGGGG + Intronic
1198202583 X:134436699-134436721 CTGCAAGAGCAGATTAGCAGAGG - Intergenic
1198321202 X:135520819-135520841 CAGAAAGAGGAGGCCAGGAGCGG + Exonic
1198551221 X:137747400-137747422 CGGACAGAGCAGACGAGCAGCGG - Intergenic
1199219385 X:145299394-145299416 AGGTATGAGCAGAGCAGGAGAGG - Intergenic
1200516008 Y:4144352-4144374 AGGCATGAGCAGAGCAGGAGAGG - Intergenic
1200516969 Y:4154607-4154629 AGGCATGAGCAGGGCAGGAGAGG - Intergenic
1201344357 Y:12966759-12966781 GGGCATGAGCAGGGCAGGAGAGG - Intergenic
1201745140 Y:17363707-17363729 AGGCATGAGCAGAGCAGGAGAGG - Intergenic