ID: 1070597806

View in Genome Browser
Species Human (GRCh38)
Location 10:77844952-77844974
Sequence CCCAATGCACAGGGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070597793_1070597806 27 Left 1070597793 10:77844902-77844924 CCTGCAGGCGTGTTCTAGAGACA 0: 1
1: 0
2: 2
3: 7
4: 96
Right 1070597806 10:77844952-77844974 CCCAATGCACAGGGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070597806 Original CRISPR CCCAATGCACAGGGGGAGGT GGG Intronic
No off target data available for this crispr