ID: 1070600322

View in Genome Browser
Species Human (GRCh38)
Location 10:77861786-77861808
Sequence TAGGAGGCATTGTTGTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070600322_1070600330 17 Left 1070600322 10:77861786-77861808 CCACTCCACAACAATGCCTCCTA 0: 1
1: 0
2: 2
3: 14
4: 191
Right 1070600330 10:77861826-77861848 TTCCACTTCTCTTGGCCCAAAGG No data
1070600322_1070600329 9 Left 1070600322 10:77861786-77861808 CCACTCCACAACAATGCCTCCTA 0: 1
1: 0
2: 2
3: 14
4: 191
Right 1070600329 10:77861818-77861840 GATTCTCGTTCCACTTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070600322 Original CRISPR TAGGAGGCATTGTTGTGGAG TGG (reversed) Intronic
900294932 1:1944060-1944082 TAGCAGACATGGTTGGGGAGAGG - Intronic
901805962 1:11738764-11738786 TGGGAGGCAGAGTTGTGCAGCGG - Intronic
905311844 1:37054581-37054603 GAGGGGGCGGTGTTGTGGAGGGG - Intergenic
907744845 1:57202866-57202888 TAGAAGACATAGTTGTGAAGAGG - Intronic
910079791 1:83327990-83328012 GAGGTGGCATTGTTATGGAAGGG - Intergenic
910718194 1:90255935-90255957 TGGGAGGCATTGTGCAGGAGGGG - Intergenic
918393753 1:184093332-184093354 TTGGAGGCAGGGTGGTGGAGTGG + Intergenic
919807486 1:201388966-201388988 TAGCAAGCATTGTTATGAAGAGG + Intronic
922348466 1:224716693-224716715 TGGGAGGCACTGTGATGGAGAGG + Intronic
1067458484 10:46440376-46440398 TAGGAGGCTGGGTTGTGCAGGGG + Intergenic
1067628714 10:47944259-47944281 TAGGAGGCTGGGTTGTGCAGGGG - Intergenic
1068612935 10:59080448-59080470 AAGGAGGCCTTGTGGTGGAGTGG - Intergenic
1069026580 10:63549242-63549264 TAGAAGGCAGAGGTGTGGAGTGG + Intronic
1069591833 10:69646628-69646650 CAGGAGGCCTTTCTGTGGAGTGG + Intergenic
1070600322 10:77861786-77861808 TAGGAGGCATTGTTGTGGAGTGG - Intronic
1071725487 10:88194195-88194217 GAGAAGGCTTTGTTGTGGAGGGG + Intergenic
1078324511 11:10368839-10368861 TAGGAGGCATTGCAGTGGAAGGG + Intronic
1078682508 11:13490483-13490505 TGGCAAGCATTGTTGTGGACCGG + Intergenic
1081386875 11:42482107-42482129 TAGTAGGCAATATTGGGGAGGGG + Intergenic
1086117340 11:83266625-83266647 CAGTAGGCATTGTTGTGCTGTGG - Intronic
1087317292 11:96617299-96617321 TAAGAGCCATTGTTGTAGAAAGG - Intergenic
1089535272 11:119157037-119157059 GAGCAGGCATAGTTGGGGAGGGG + Intronic
1092125090 12:6069478-6069500 TAGGCGGTATGGTTCTGGAGGGG - Intronic
1092383446 12:8017596-8017618 AAGAAGGCATTGTTTTGGAAGGG - Intergenic
1098181763 12:67854790-67854812 GAGGAGACAGTGTTGTAGAGTGG + Intergenic
1099334220 12:81333099-81333121 TAGGAAGAGCTGTTGTGGAGGGG - Intronic
1100271105 12:93025654-93025676 TAGGAGGCAGTGTTGTGTAGTGG + Intergenic
1100412115 12:94330193-94330215 TAGTAGCATTTGTTGTGGAGAGG - Intronic
1100633620 12:96413177-96413199 TAGGAGTCATTGGAGTGAAGGGG + Intergenic
1102308082 12:111821811-111821833 TAGGAACTATTGTTATGGAGGGG - Intergenic
1103605869 12:122085729-122085751 TAGGGGACATTGGCGTGGAGTGG + Intronic
1103882365 12:124175894-124175916 TGGCAGGCATTTTTCTGGAGGGG - Intronic
1107331443 13:39305540-39305562 TAGGAAGCATTGTTTTGAAATGG - Intergenic
1107695591 13:42996151-42996173 AATGAGGCATTGTTGGGGAATGG + Intergenic
1109142366 13:58730456-58730478 TAGGAGGGATCATTCTGGAGAGG + Intergenic
1110721632 13:78768615-78768637 TAGGAGGCCTTGTTGCGTATGGG - Intergenic
1111034366 13:82652441-82652463 TATGAGGCTTTGTTTTGGAAGGG - Intergenic
1114749711 14:25189381-25189403 TATCAGGGATTGTTGTGGGGTGG + Intergenic
1115360207 14:32492099-32492121 TATGAGGTATTTTTGTTGAGGGG - Intronic
1115912737 14:38274541-38274563 TAGGAGGGACTGTGGTGGGGTGG + Intergenic
1116869837 14:50060532-50060554 TAGGAGGCTCTGTCATGGAGGGG - Intergenic
1117604120 14:57407987-57408009 TTTGAGGCATTGGTGTGGTGGGG + Intronic
1119782600 14:77287150-77287172 TAGGAGGCAGGTTTGAGGAGAGG + Intronic
1121237297 14:92401603-92401625 AGAGAGGCAGTGTTGTGGAGTGG + Intronic
1121586203 14:95064624-95064646 GAGGAGGCGTGGCTGTGGAGGGG + Intergenic
1123921331 15:25071840-25071862 TTGCAGGCATTGTTGTGGGTGGG + Intergenic
1126482930 15:49146807-49146829 TAGGAACCATTTTTGAGGAGAGG - Intronic
1128322327 15:66702412-66702434 CGGGAGGCACTTTTGTGGAGGGG + Exonic
1128429987 15:67583280-67583302 TTGGAGGGCTTGTTTTGGAGTGG + Intronic
1128943676 15:71807813-71807835 CAGGAGGCCTAGTTGTGGGGAGG - Intronic
1130460514 15:84155938-84155960 CAGGTGGCATTGGTGGGGAGGGG + Intergenic
1132367038 15:101265148-101265170 TGGGGAGCATTGTTGGGGAGGGG + Intergenic
1133601928 16:7348220-7348242 TAGTAGGCATTTTTGGGTAGCGG - Intronic
1133711581 16:8406693-8406715 GAGTAGGCATGGTTGGGGAGGGG - Intergenic
1133830161 16:9315620-9315642 AAGGAGACCTTGTTGTGGAAAGG + Intergenic
1134634012 16:15778621-15778643 CAGCAGGCATTGTGGTGCAGTGG - Intronic
1134904588 16:17969468-17969490 TAGGTGGCATTGATGTGGGAAGG - Intergenic
1135573767 16:23569009-23569031 TTGGAGGAATTGGTGTGGATGGG + Intronic
1137244960 16:46694643-46694665 TAAGAGACAGTGTTGTGGGGGGG - Intronic
1137301406 16:47151743-47151765 TAGGAGGCAGTGCTGGGGGGTGG - Intergenic
1137891621 16:52169071-52169093 TGGAAGGCACTGTTGTGAAGTGG - Intergenic
1142541111 17:660173-660195 TAGGATGCATCGTTGGTGAGTGG - Intronic
1143050932 17:4125191-4125213 CAGAAGGCATTGTTGAGGAAGGG - Intronic
1144267318 17:13583548-13583570 TAAGGGGCATTTTTCTGGAGGGG - Intronic
1145906939 17:28521483-28521505 CAGGAGGCAGTGATGCGGAGCGG + Intronic
1145974561 17:28976736-28976758 AAGGTGGCTTTGTTGTGTAGGGG - Intronic
1146908383 17:36632375-36632397 TAGGAAGCAGTGTGGTGGAGTGG + Intergenic
1146958815 17:36954805-36954827 CAGGAGGCAGTGTGGTGCAGAGG - Intronic
1149168045 17:53777624-53777646 TGGGAGGCAATGTTGTTAAGGGG - Intergenic
1150627198 17:66849246-66849268 ATGGATGCATTGTTGTGGGGAGG + Intronic
1151525094 17:74659704-74659726 AGGGAGGCATTGTAGTGCAGTGG - Intergenic
1151801042 17:76379984-76380006 TACCAGGCATTGGGGTGGAGGGG - Intronic
1151986121 17:77544980-77545002 TGAGAGGCATTTTTGTTGAGAGG + Intergenic
1203213626 17_KI270730v1_random:103444-103466 TGGAATGCAATGTTGTGGAGTGG + Intergenic
1154192167 18:12239382-12239404 CAGGAGGCAGAGTTGTGGGGAGG - Intergenic
1156375071 18:36506868-36506890 GAGGAGGCATTCTTCTGGATGGG - Intronic
1157276811 18:46316349-46316371 CAGTAGGCATTGTTGTTGTGTGG - Intergenic
1157429313 18:47611566-47611588 TAGGAGGCATTGGAGAGTAGTGG - Intergenic
1158034171 18:53004575-53004597 TAGGAGGTATTATTGTTGTGTGG - Intronic
1160681500 19:413464-413486 CAGGAGGACTTGCTGTGGAGGGG - Intergenic
1161092568 19:2369329-2369351 GAGCAGGCATTTTTGTGAAGAGG + Intergenic
1162258315 19:9511335-9511357 TAGGAACTATTGTTATGGAGAGG - Intergenic
1163020203 19:14477532-14477554 TAGGAGGCCTTGTGGGAGAGGGG + Intergenic
1165103383 19:33453891-33453913 TAGGAGGCAGTATAGTAGAGTGG - Intronic
1166035426 19:40164791-40164813 TGGGAGGCTTTGGTGGGGAGAGG - Intergenic
1167736115 19:51295558-51295580 TCAGAGGCATAGATGTGGAGGGG + Intergenic
926070168 2:9881829-9881851 TACCAGGCATTGGGGTGGAGTGG + Intronic
926092344 2:10059021-10059043 TAGGAGCCATTGTGGTGGCCAGG - Intronic
926690835 2:15732231-15732253 TAGCAGGTATTGTGTTGGAGAGG + Intronic
927862597 2:26569479-26569501 TAGGAGGCGTTATGGAGGAGAGG + Intronic
931257473 2:60585741-60585763 TGGGAGCCAGTGTTATGGAGAGG - Intergenic
932735513 2:74251684-74251706 CAGGAGGCCATGTGGTGGAGAGG + Intronic
933252104 2:80040243-80040265 TAAGAGTCATTATTCTGGAGAGG - Intronic
933559636 2:83874470-83874492 TAAGGGGCATTGTTGGGGAGGGG + Intergenic
936523158 2:113224977-113224999 TAGGAGGCAGTATGGTGTAGAGG + Intronic
937054728 2:118924576-118924598 TAGGAAGCAGTATTGTGCAGTGG + Intergenic
937511136 2:122596112-122596134 TATGAGGCATTCTTGTGGTGAGG - Intergenic
938727998 2:134123566-134123588 TAGGAGGCATGGAGGAGGAGTGG + Intronic
939349747 2:141020068-141020090 TAGAGGGCATTGCTGTGGACTGG - Exonic
941026369 2:160460576-160460598 AAGCAGGCACTGTTGTGTAGTGG - Intronic
941399567 2:165014106-165014128 TAGCAGGCATAGTTGTGTGGAGG - Intergenic
942328603 2:174797257-174797279 TAGCATGCATTGTGGTAGAGGGG - Intergenic
942620484 2:177839633-177839655 TAGGAGGCATTTTTTTGGTGAGG - Intronic
943051230 2:182915680-182915702 TAGGAGGCATTTCTGTAAAGGGG + Intronic
944651922 2:201838812-201838834 TAGAAGGCCTTCTAGTGGAGGGG - Intronic
945673598 2:212831274-212831296 TGGGAGGCATCCTTGTGCAGAGG + Intergenic
946823169 2:223650382-223650404 CAGGAGACATTGATGTGGAGGGG + Intergenic
1168807713 20:682472-682494 GAGGAGGCAGTGTGGTGGAGTGG - Intergenic
1168815443 20:733683-733705 GAGGAGGCATTTCAGTGGAGAGG + Intergenic
1169534519 20:6523991-6524013 TATGAAGGATTGTTTTGGAGAGG + Intergenic
1172036442 20:32014176-32014198 TAGGATTCAATGTGGTGGAGTGG - Intronic
1173024960 20:39299045-39299067 TGGGAAGCATTGATGGGGAGTGG + Intergenic
1175407006 20:58741462-58741484 TTGAAGGCATTGGGGTGGAGTGG - Intergenic
1175502078 20:59457704-59457726 TAGGAGGCAGTACTGTGGAAAGG + Intergenic
1175684165 20:61015158-61015180 TGGGAGGCATTGGTGTGAATAGG - Intergenic
1178271860 21:31197896-31197918 TGGGAGGCATCGTAGTGTAGTGG - Intronic
1182954108 22:34404780-34404802 TTGGAGGCATTGCTCTGGCGTGG + Intergenic
1184927583 22:47654101-47654123 CAGGAGGCTATGTTGTGAAGGGG + Intergenic
949893018 3:8747168-8747190 TGGGAGGCAGTGTGGTGAAGTGG + Intronic
950144723 3:10640813-10640835 TTGGAGGAAATGTTGTGGAAAGG + Intronic
950689433 3:14643854-14643876 TAGGAGGCACTCTTGGGGGGAGG - Intergenic
951011008 3:17679707-17679729 TAGGAGAAATTTGTGTGGAGGGG - Intronic
951660254 3:25055639-25055661 TAGGAGGAATTGGGGAGGAGTGG + Intergenic
952448300 3:33405422-33405444 AAGGAGGCAATGTTCTGGCGTGG - Intronic
952883493 3:37999251-37999273 TTGGAGGGATGGTTGAGGAGTGG + Intronic
952969137 3:38639854-38639876 TAGGAGGCAATGTGGTGCAATGG - Intronic
955899875 3:63741157-63741179 CAGGAGGCATTATGGTGCAGAGG - Intergenic
956655802 3:71549025-71549047 TTTGAGGCAGTGTTGTGCAGTGG - Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
958734765 3:97995631-97995653 GAGGAGGGATTGTTGGGTAGGGG + Intronic
959808656 3:110590725-110590747 TAGGGTACATTGTTGAGGAGGGG + Intergenic
961051358 3:123749845-123749867 TAGGAGGCAGTGTTGTGCAATGG - Intronic
963594633 3:147310001-147310023 TGGGAGGCAATGTAGAGGAGTGG - Intergenic
969978863 4:11133455-11133477 TAAGAGGCATGGTGGAGGAGAGG - Intergenic
970578995 4:17456605-17456627 GAGGAGGCTTTGTTGTCCAGTGG - Intergenic
971983657 4:33790717-33790739 CAGGAGGCAGTGTTGTACAGTGG - Intergenic
972302907 4:37802288-37802310 TGGGAGGCAGTGTGGTGCAGTGG - Intergenic
973265816 4:48209078-48209100 AGGGAGGCATTGATGGGGAGTGG - Intronic
973961157 4:56111183-56111205 TAGGAGGTATGGATGTGGACGGG + Intergenic
975061090 4:70001168-70001190 TAGAAGGCAGTGTTATAGAGTGG + Intronic
977471564 4:97449649-97449671 TATATGGCATTCTTGTGGAGGGG - Intronic
980045657 4:127985290-127985312 TTGGAGGTATTGTTGGAGAGGGG + Intronic
982251467 4:153411533-153411555 CATTAGGCATTGTTGTGGAGAGG + Intronic
986021961 5:3812828-3812850 TAGAAGGCTTTGCTGTGGGGTGG + Intergenic
986507092 5:8463428-8463450 GAGGAGCTATTTTTGTGGAGTGG + Intergenic
987357097 5:17073422-17073444 AAGGAGTCAGTGCTGTGGAGTGG + Intronic
987590083 5:19913347-19913369 TAGAAGGAATTGGTGTGTAGGGG + Intronic
987739213 5:21883888-21883910 AAGGAGGCATTGTTTTGGGAGGG + Intronic
988883491 5:35531301-35531323 TGGGAGGCATCCCTGTGGAGAGG + Intergenic
989258712 5:39395359-39395381 TTGAAGGCAGGGTTGTGGAGGGG - Intronic
995887857 5:116916490-116916512 GAGGAGGCAGTGGTGTGCAGTGG + Intergenic
997340705 5:133142363-133142385 TTGGAGCCCTTGTTGGGGAGGGG + Intergenic
1004884745 6:20040712-20040734 TAGGATCAACTGTTGTGGAGAGG + Intergenic
1006183254 6:32166532-32166554 TAGGACTCGTTGTAGTGGAGCGG - Exonic
1006429208 6:33984782-33984804 TAGGAGGCATCCGTGTCGAGGGG + Intergenic
1007941093 6:45782272-45782294 TGGGAGGCACAGTTTTGGAGGGG + Intergenic
1007968635 6:46028243-46028265 GAGGAGGCATTGGTGTTGACTGG - Intronic
1008836124 6:55832674-55832696 TAGGAGGCATTGATGTGGTTAGG - Intronic
1011341252 6:86317066-86317088 CAGGAAGGACTGTTGTGGAGTGG - Intergenic
1012312759 6:97748516-97748538 GAGGAGGCATTACTGTGCAGTGG + Intergenic
1015044176 6:128759445-128759467 TAGGATGGATTCTTGTTGAGGGG + Intergenic
1015107804 6:129557149-129557171 CTGGAGGCATTGTCCTGGAGTGG - Intergenic
1015921546 6:138270933-138270955 CAGGAGGCATTGGGGTGAAGAGG + Intronic
1016665892 6:146639759-146639781 CAGGAGGCATGCTTGTGCAGGGG - Intronic
1019369453 7:653343-653365 TGGGAGGCAGTGTTGGGAAGAGG - Intronic
1020580699 7:9996243-9996265 TAGGAGGCACTGTGTTTGAGAGG - Intergenic
1020659487 7:10965696-10965718 TAGTAGGCATTGTTGAGCTGTGG + Intergenic
1022055702 7:26731832-26731854 TAGGTGGCATTGGAGTGTAGGGG - Intronic
1024374714 7:48623857-48623879 TAGGGATCATGGTTGTGGAGTGG + Intronic
1025259952 7:57412288-57412310 TTGAAGGCATTCTTGTGCAGTGG + Intergenic
1028037984 7:86009466-86009488 CAGGAGGCATTTTTGGGGAATGG + Intergenic
1028498676 7:91492300-91492322 TAGGAGGTATTGTCGTTGGGTGG + Intergenic
1029114476 7:98230327-98230349 TAGGAGACATTGTTCTGTTGGGG - Intronic
1030746458 7:113172237-113172259 TGGGAGCCATTGGTATGGAGGGG + Intergenic
1032321246 7:130888222-130888244 TGGGAGGCACTGCTGTGGACAGG + Intergenic
1033006184 7:137566755-137566777 CAGGAGAGATTGTTTTGGAGAGG - Intronic
1033895533 7:146064942-146064964 TAGTAGTCATTCTTGTGTAGTGG - Intergenic
1037005932 8:13779835-13779857 TAAGAGACATTGTTGGGGGGAGG - Intergenic
1037794766 8:21983635-21983657 AGTGAGGCATTGTTGGGGAGTGG + Intronic
1037920344 8:22801394-22801416 CAGGAGGCAGTGTGGTGCAGTGG - Intronic
1038335470 8:26642036-26642058 TTGGCTGCATTGTTGTGGGGTGG + Intronic
1038515023 8:28180770-28180792 GAGGAGGGATTGGTGTGGTGGGG - Intronic
1038523949 8:28257320-28257342 TGAGAGGCACTGTTTTGGAGTGG + Intergenic
1040532780 8:48279133-48279155 AAGGAAGCATTGGTGTGGAAGGG + Intergenic
1043608163 8:82028104-82028126 AAGAAGGCATTGTTGTTGATAGG + Intergenic
1044238880 8:89865293-89865315 TAGGAGGCAATGTTGTAGGTGGG - Intergenic
1046676650 8:117116008-117116030 TAGTAGAGATTTTTGTGGAGGGG + Intronic
1047224840 8:122947645-122947667 AAGGAGGCATTGTTTTGCAGAGG + Intronic
1049397176 8:142406381-142406403 AAGGAGCCATCGTTGTTGAGGGG - Intergenic
1051283508 9:15468341-15468363 TAGGAGGCATTGTGATGGATGGG + Intronic
1055621302 9:78127588-78127610 AAGGAGGCATTGTTGAAGTGTGG - Intergenic
1057843147 9:98502342-98502364 GAGGAGGCCTTGCAGTGGAGTGG - Intronic
1059675801 9:116538068-116538090 TAGGAGGCATTGTTGTATAGTGG - Intronic
1186728166 X:12379101-12379123 TAGGGGGCAATCTTGAGGAGAGG + Intronic
1189000134 X:36935249-36935271 TAAGAGCTATAGTTGTGGAGGGG - Intergenic
1189673439 X:43437067-43437089 TAGGGGCCATTTTTGTGCAGTGG + Intergenic
1192082010 X:68057416-68057438 TGGGAGGCGGAGTTGTGGAGGGG + Intronic
1193672758 X:84409708-84409730 TACCAGGCACTGTTGTGGGGTGG + Intronic
1194639154 X:96381748-96381770 AAGGAGGCATTGGTGTTGAATGG + Intergenic
1196053550 X:111331179-111331201 TAGGAGCCATGGTTCTGGGGAGG + Intronic
1197969223 X:132097457-132097479 TAGGAGGGAGTGATGGGGAGGGG - Intronic
1198174835 X:134145065-134145087 TATGAGGCCTGGTTTTGGAGGGG - Intergenic
1198910593 X:141609122-141609144 GAGGAGGCAGTGTTATGTAGTGG - Intronic
1201178308 Y:11322824-11322846 TAGGATGCATTGTTGGGACGGGG + Intergenic
1201770677 Y:17614563-17614585 TAAGGGGCATCGTTGGGGAGGGG - Intergenic
1201830878 Y:18291423-18291445 TAAGGGGCATCGTTGGGGAGGGG + Intergenic
1202378738 Y:24259242-24259264 CAGGTGGCATTGGTGGGGAGGGG - Intergenic
1202492044 Y:25410879-25410901 CAGGTGGCATTGGTGGGGAGGGG + Intergenic