ID: 1070603182

View in Genome Browser
Species Human (GRCh38)
Location 10:77879799-77879821
Sequence CAGGAAAAACAGATGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070603168_1070603182 27 Left 1070603168 10:77879749-77879771 CCTGGAAACTGGAAGGATGATGT 0: 1
1: 0
2: 3
3: 22
4: 249
Right 1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG No data
1070603174_1070603182 0 Left 1070603174 10:77879776-77879798 CCTTGCTGAAAGGGGGAAGCCTG 0: 1
1: 0
2: 2
3: 19
4: 162
Right 1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070603182 Original CRISPR CAGGAAAAACAGATGGGGGA GGG Intronic
No off target data available for this crispr