ID: 1070603466

View in Genome Browser
Species Human (GRCh38)
Location 10:77881879-77881901
Sequence GTCCCCGACCTGTGAAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070603466_1070603468 -7 Left 1070603466 10:77881879-77881901 CCCAGGCTTCACAGGTCGGGGAC No data
Right 1070603468 10:77881895-77881917 CGGGGACATTCTGTCCACAAAGG No data
1070603466_1070603470 3 Left 1070603466 10:77881879-77881901 CCCAGGCTTCACAGGTCGGGGAC No data
Right 1070603470 10:77881905-77881927 CTGTCCACAAAGGCCAAAGAGGG No data
1070603466_1070603472 15 Left 1070603466 10:77881879-77881901 CCCAGGCTTCACAGGTCGGGGAC No data
Right 1070603472 10:77881917-77881939 GCCAAAGAGGGCAACTACAAAGG No data
1070603466_1070603469 2 Left 1070603466 10:77881879-77881901 CCCAGGCTTCACAGGTCGGGGAC No data
Right 1070603469 10:77881904-77881926 TCTGTCCACAAAGGCCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070603466 Original CRISPR GTCCCCGACCTGTGAAGCCT GGG (reversed) Intronic