ID: 1070603470

View in Genome Browser
Species Human (GRCh38)
Location 10:77881905-77881927
Sequence CTGTCCACAAAGGCCAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070603467_1070603470 2 Left 1070603467 10:77881880-77881902 CCAGGCTTCACAGGTCGGGGACA No data
Right 1070603470 10:77881905-77881927 CTGTCCACAAAGGCCAAAGAGGG No data
1070603466_1070603470 3 Left 1070603466 10:77881879-77881901 CCCAGGCTTCACAGGTCGGGGAC No data
Right 1070603470 10:77881905-77881927 CTGTCCACAAAGGCCAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070603470 Original CRISPR CTGTCCACAAAGGCCAAAGA GGG Intronic