ID: 1070603470 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:77881905-77881927 |
Sequence | CTGTCCACAAAGGCCAAAGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1070603467_1070603470 | 2 | Left | 1070603467 | 10:77881880-77881902 | CCAGGCTTCACAGGTCGGGGACA | No data | ||
Right | 1070603470 | 10:77881905-77881927 | CTGTCCACAAAGGCCAAAGAGGG | No data | ||||
1070603466_1070603470 | 3 | Left | 1070603466 | 10:77881879-77881901 | CCCAGGCTTCACAGGTCGGGGAC | No data | ||
Right | 1070603470 | 10:77881905-77881927 | CTGTCCACAAAGGCCAAAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1070603470 | Original CRISPR | CTGTCCACAAAGGCCAAAGA GGG | Intronic | ||