ID: 1070605484

View in Genome Browser
Species Human (GRCh38)
Location 10:77895265-77895287
Sequence AAGGGAAATCCTGGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 532}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605484_1070605492 -3 Left 1070605484 10:77895265-77895287 CCTTCCTCCCCAGGATTTCCCTT 0: 1
1: 0
2: 7
3: 58
4: 532
Right 1070605492 10:77895285-77895307 CTTCTCCTCTGGCTGTGCTTTGG No data
1070605484_1070605494 28 Left 1070605484 10:77895265-77895287 CCTTCCTCCCCAGGATTTCCCTT 0: 1
1: 0
2: 7
3: 58
4: 532
Right 1070605494 10:77895316-77895338 GACCCTAGCTGATGTTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605484 Original CRISPR AAGGGAAATCCTGGGGAGGA AGG (reversed) Intronic
900091089 1:921045-921067 AAGAGAAATGCTGGGGAGCCTGG + Intergenic
900156545 1:1205537-1205559 GAGGGGAGGCCTGGGGAGGAGGG - Intronic
900482126 1:2904466-2904488 AAGGGATGCCCTGGGGAGGGAGG + Intergenic
901633615 1:10659620-10659642 ACGGGCAACCCTGGTGAGGAAGG + Intronic
901872655 1:12147081-12147103 GGGGGAAGGCCTGGGGAGGAGGG + Intergenic
902042497 1:13503020-13503042 AAGGGAGCTCCTGGGGTGGTGGG + Intronic
902059651 1:13631332-13631354 AAGAGAAATTCTGGGGAAGAGGG + Intergenic
902684466 1:18066915-18066937 AGGGGAGATGCTGGGGAAGACGG + Intergenic
902730315 1:18364796-18364818 CAGGGAGGTCCTGGGGATGAGGG - Intronic
903135867 1:21308831-21308853 AAGGGAAACCCTGGGCAGGCAGG - Intronic
903656910 1:24955117-24955139 AAGGGCAGATCTGGGGAGGAAGG - Intronic
904089174 1:27932540-27932562 AAGGAGAAAGCTGGGGAGGAGGG - Intergenic
904280310 1:29414123-29414145 AGGGGATACCCTGGGCAGGAGGG + Intergenic
904624243 1:31793246-31793268 AAGGGAATCCCTGGCGAGGAGGG + Intronic
905126287 1:35718310-35718332 CAGAGAAGTCCTGGGGAGAAGGG + Intronic
905429180 1:37909308-37909330 AAGGAGCAGCCTGGGGAGGAGGG - Intronic
905952508 1:41964098-41964120 AAAGGAAAACTTGTGGAGGAGGG + Intronic
906612987 1:47216094-47216116 AATGGAAACCCTGGGGAGGAAGG + Intergenic
907503655 1:54901914-54901936 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
908106938 1:60854896-60854918 AAGGCAGATGCTGGGGAGGAGGG - Intergenic
908175927 1:61555136-61555158 AAAGGAAAGCCAGGAGAGGAAGG - Intergenic
908249792 1:62256364-62256386 AAGGAAAATTGTGGGGTGGAGGG - Intronic
909535266 1:76728633-76728655 GAGGGAGATGCTGAGGAGGAGGG - Intergenic
910314658 1:85868589-85868611 AGGGGACTTCCTGGAGAGGATGG - Exonic
911070977 1:93831690-93831712 AAGGAGCAGCCTGGGGAGGAGGG - Intronic
911450420 1:98054217-98054239 AAGGGAGGACCAGGGGAGGAGGG - Intergenic
911523145 1:98952355-98952377 AAGGTACATCCTTGTGAGGAGGG + Intronic
914251013 1:145921375-145921397 AGGAGAAATGCTAGGGAGGATGG + Intergenic
914807659 1:151003327-151003349 AGGTGAAATGCTGGTGAGGAAGG + Intronic
915460634 1:156068594-156068616 CTGGGAAATCCTGAGGAAGAGGG - Intronic
915899052 1:159833406-159833428 AGTGGAGTTCCTGGGGAGGAGGG + Intronic
915919303 1:159962210-159962232 AAGGGAAAACATGGGGTAGAGGG + Intergenic
916832665 1:168509021-168509043 TAGGGAATCACTGGGGAGGAAGG - Intergenic
917188794 1:172391314-172391336 GAGGGAAATCCCGGGGAAGGGGG + Intronic
917208032 1:172598209-172598231 AAAGGAAATTCTGTGGAGAAAGG - Intronic
917579735 1:176363433-176363455 AAGGGAAATCCCAGGGTGGCTGG + Intergenic
918203311 1:182287516-182287538 AAGGTTAATCCTGGGGAAGTTGG - Intergenic
919539759 1:198831671-198831693 AAGGGAAGTGCTGGGAAGGAAGG - Intergenic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
920434263 1:205938109-205938131 TGGGGAAATCCTGGGGACGGGGG - Intronic
920901625 1:210114868-210114890 AAGGAGCAGCCTGGGGAGGAGGG + Intronic
921520041 1:216147211-216147233 GAGGAACAACCTGGGGAGGAAGG - Intronic
921542411 1:216432146-216432168 AAAGGAAATCATAGGGAGTATGG + Intergenic
921667751 1:217893124-217893146 AAGTGAAACCCTGGGTAAGAAGG + Intergenic
922033270 1:221824922-221824944 GAGGGAGTTGCTGGGGAGGAGGG - Intergenic
922363645 1:224844543-224844565 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
924262424 1:242245902-242245924 GAGGGAAATGCTGTGAAGGAAGG - Intronic
924316003 1:242797372-242797394 GAGAGAAATACAGGGGAGGAAGG - Intergenic
1063509691 10:6633641-6633663 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1063527770 10:6801138-6801160 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1063630820 10:7732208-7732230 AAGGCAAAGCCTACGGAGGAAGG - Intronic
1063884879 10:10567457-10567479 AAGGGAAAGGCAGGGAAGGAAGG + Intergenic
1063995091 10:11611555-11611577 AAGGGAAACAATGGGGCGGAGGG - Intronic
1064251647 10:13710632-13710654 AAATGCAATCCTGGGAAGGAAGG + Intronic
1064415530 10:15146107-15146129 AAGTGAAACCCTGGGGAAGAGGG - Intronic
1064773410 10:18749074-18749096 AAGGGAAAACCTGGACAGAATGG - Intergenic
1066437455 10:35407309-35407331 AAGGAGCAGCCTGGGGAGGAGGG + Intronic
1066455681 10:35569440-35569462 AAGGGAAGTCGTGGAGAGGCAGG + Exonic
1067576634 10:47412907-47412929 CAGGGAGCTCCTGGGGAGGGCGG - Intergenic
1067855539 10:49789461-49789483 AAGGGAATTCCTTGTGAGGGAGG - Intergenic
1068544573 10:58331424-58331446 TTGGAAAATGCTGGGGAGGAAGG - Intergenic
1068786966 10:60987355-60987377 AAGGCAAATTCAGGAGAGGATGG - Intronic
1068809007 10:61234773-61234795 AAGAGAAATAGTGGGGAGGAAGG - Intergenic
1070605484 10:77895265-77895287 AAGGGAAATCCTGGGGAGGAAGG - Intronic
1070803333 10:79256102-79256124 AGGGAAAATCATGGGGAGGAAGG - Intronic
1070828306 10:79403855-79403877 CAGGAAAACCCTGGGGAGGGGGG + Intronic
1071721432 10:88150385-88150407 AAGTGAAATCATGGAGATGAGGG - Intergenic
1072067953 10:91888635-91888657 AAGAGAAATCCTGGGAAAGGGGG - Intergenic
1072884429 10:99261244-99261266 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1073071480 10:100796760-100796782 AAGGGAAATGATGGGGATGCAGG - Intronic
1073679169 10:105683297-105683319 GTGAGAAATCCTGGGGTGGAGGG - Intergenic
1075199079 10:120387249-120387271 AAGGGATATGTTGGAGAGGAGGG - Intergenic
1075268810 10:121031079-121031101 AAGGCAAATGTTGGGGAGGGAGG - Intergenic
1075753361 10:124791757-124791779 AAGGGCAGTCCCGGGGAGGACGG - Exonic
1076991650 11:279028-279050 AAGGGAGGTGCAGGGGAGGAAGG + Intronic
1077766478 11:5164365-5164387 AAGGAGCAGCCTGGGGAGGAGGG + Intronic
1078123595 11:8536095-8536117 AAGGGTGAACGTGGGGAGGAGGG + Intronic
1078189716 11:9083168-9083190 AAGGGAAATGCATGGAAGGAGGG + Intronic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1078944373 11:16047047-16047069 TGGGGAAATTATGGGGAGGAAGG + Intronic
1079298277 11:19254314-19254336 AAGGGAAAGACTGGTGAGAAAGG - Intergenic
1081836459 11:46159566-46159588 AAGGGAACTTTTGGGGAAGATGG + Intergenic
1081851038 11:46275469-46275491 AAGAGAAATCCTGGGGAAAGGGG - Intergenic
1083095491 11:60246798-60246820 AGTGGAAATGCTGGGTAGGAAGG - Intergenic
1083283415 11:61641748-61641770 AAGGAAAATCCAGAGGAGAAGGG + Intergenic
1086290152 11:85299506-85299528 AAAGGCAATAATGGGGAGGAAGG - Intronic
1087487160 11:98770763-98770785 AAGGGAGACCATGGGGAAGAGGG + Intergenic
1089099969 11:115954470-115954492 AAGGGAAACACTGGTGAGAAAGG + Intergenic
1089680297 11:120115578-120115600 ACCGAAAATCCTGGGGAGGCTGG + Intronic
1089799064 11:121008874-121008896 AAGGGAAAACCTGGGGTGATGGG + Intergenic
1090212553 11:124932596-124932618 AAGGTAAATCTTGGGGAGGCAGG + Intronic
1091016050 11:132051665-132051687 AGGGGTCCTCCTGGGGAGGAGGG - Intronic
1091142232 11:133245042-133245064 CAGGGAAATCATGAGGAAGATGG - Intronic
1091547374 12:1510407-1510429 AAAGGAAATACTGAGGAGGGAGG + Intergenic
1093071251 12:14708917-14708939 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1093086464 12:14870816-14870838 AAGGGAATTCCTGGAAAGGATGG - Intronic
1093292736 12:17348394-17348416 ATGGGATATAATGGGGAGGAAGG - Intergenic
1095356304 12:41279907-41279929 TAGGGAATTCCTGGGCAAGATGG + Intronic
1095956154 12:47807557-47807579 AATGGGAATGCTGGGGAGGAGGG - Intronic
1095981846 12:47978604-47978626 AAGGGAGAGCCTGGAGATGACGG - Exonic
1096198061 12:49661842-49661864 AATGGGAATCCTGGACAGGAAGG - Intronic
1096524209 12:52200969-52200991 GGGGGAAATCCTGGTGAGGACGG + Intergenic
1096524481 12:52202443-52202465 GGGGGAAAGCCTGGTGAGGACGG + Intergenic
1096530048 12:52236681-52236703 TAGGGACAACCTGGGGTGGAAGG - Intronic
1096656281 12:53094475-53094497 AAGTGTAATCCTGGGGTGGTGGG + Intergenic
1096847710 12:54417261-54417283 AAGGGAAATTTAGGGGAGGGGGG + Intronic
1097417140 12:59327262-59327284 GAGGAACAACCTGGGGAGGAAGG + Intergenic
1097981780 12:65742645-65742667 AAGGGAAATCCGGATAAGGATGG + Intergenic
1098919809 12:76293094-76293116 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1099669830 12:85675593-85675615 AAGGGAAATGATAGGGAAGAAGG + Intergenic
1099836188 12:87911450-87911472 GAGGGGCAGCCTGGGGAGGAGGG + Intergenic
1100525503 12:95415681-95415703 AAGGAAAGTAGTGGGGAGGAGGG - Intergenic
1101041433 12:100759819-100759841 AAAGGAAAACCTTGGGAGCATGG - Intronic
1102972035 12:117176423-117176445 ATGGGACATCCTGGAGAGTACGG + Intronic
1103649827 12:122423378-122423400 AAAGGAAATCCCAGGGGGGAAGG - Intergenic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1104149583 12:126069852-126069874 AAGGGAAATTCTAGGGAAGATGG + Intergenic
1104458475 12:128934702-128934724 AAGAGAATTCCTGGGCAGGCTGG + Intronic
1105359848 13:19699941-19699963 AAGGAAGTTCCTGGGGAGTAAGG - Intronic
1106363450 13:29053524-29053546 AAGGGAAATTCAGGGGATTATGG - Intronic
1106375979 13:29188741-29188763 AAGGGAACTCCTGGGAAAGAAGG - Intronic
1106869165 13:34000378-34000400 AAAGGAAATCATGAGGAGGAAGG - Intergenic
1107082287 13:36387861-36387883 AGGGGAACTCCTGGGGAGAAAGG - Intergenic
1107315683 13:39129202-39129224 AAGTGAAATCTTGTGAAGGAAGG + Intergenic
1107466988 13:40660160-40660182 CAGGGAGATCCTGGGGGGGCTGG + Intronic
1107683232 13:42871461-42871483 GAGGAACAACCTGGGGAGGAAGG + Intergenic
1108251101 13:48568895-48568917 TAGGGAGATCCTGGGGGGAAAGG + Intergenic
1108913504 13:55582293-55582315 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1108919634 13:55659022-55659044 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1108927815 13:55775291-55775313 AAGGGAAAAACTGGGGAAGAAGG + Intergenic
1109438396 13:62337016-62337038 AAGGAAAATAGAGGGGAGGAAGG - Intergenic
1109515339 13:63436526-63436548 AAAGGAACTACTGGGCAGGAGGG + Intergenic
1110343517 13:74419410-74419432 GAGGGAAACCATGGGAAGGAAGG - Intergenic
1110410572 13:75200084-75200106 GAGGGAAAGCCAGGGCAGGAGGG + Intergenic
1110978390 13:81867803-81867825 GAGGGGCAGCCTGGGGAGGAGGG - Intergenic
1111426806 13:88095363-88095385 AAGGGAAATGCGGGGGGGGTGGG - Intergenic
1111586697 13:90291447-90291469 AAGAGAAACCCTGGAAAGGAGGG + Intergenic
1112712375 13:102144302-102144324 AAGGAAAATCATGGAGAAGATGG - Intronic
1112888136 13:104198932-104198954 AAGACAAATCCTGGGGAGAATGG + Intergenic
1113083083 13:106536842-106536864 AACATAAATCCTGGGGTGGACGG - Intergenic
1113094181 13:106646349-106646371 AAGGGAAATCTTGATGGGGAAGG - Intergenic
1113892438 13:113743494-113743516 AAGGGCTTCCCTGGGGAGGACGG + Intergenic
1114219080 14:20681386-20681408 AAGGGAAAACCGGCAGAGGAAGG - Intergenic
1116534866 14:46016451-46016473 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1117042853 14:51783139-51783161 AAAGGAAATTCAGGGGAGAAAGG - Intergenic
1117275208 14:54187153-54187175 AGGGGAGATCTGGGGGAGGAGGG - Intergenic
1117446265 14:55806430-55806452 AAGGAAATTCCTTGTGAGGAAGG + Intergenic
1118990343 14:70791827-70791849 CAGGGAGCTCCTGGAGAGGAGGG + Intronic
1119957263 14:78812142-78812164 AAAAGAAATCTTGGGGATGATGG - Intronic
1122363984 14:101183510-101183532 GAGAGAAACCCTGGGCAGGAAGG + Intergenic
1123160138 14:106270179-106270201 GAGGGAAATAATGGGGAGGCAGG - Intergenic
1123882578 15:24689598-24689620 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1123971207 15:25509585-25509607 AATGGAAGACCTGGGGAGGAAGG + Intergenic
1124395369 15:29295923-29295945 AAGTGAAACCTTGGGGAAGAGGG + Intronic
1124409030 15:29420350-29420372 AAGGGAACTCCTGGGGAAAGGGG + Intronic
1124847400 15:33304947-33304969 AAGGGAAAACCTGAGGGGGGTGG + Intergenic
1125160877 15:36642106-36642128 GAGGGAAATACTGGGCAGGTGGG - Intronic
1125606119 15:40940953-40940975 TCAGGAAATCCTGGGGAGAAGGG - Intergenic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1128091040 15:64919072-64919094 AAGGGAAATCCTGTGGTTGGAGG + Intronic
1128344382 15:66844301-66844323 GAGGGGAAGCCTGGGGAAGAGGG - Intergenic
1129075849 15:72995363-72995385 ATGGGAAATCCTTGGGAGAAGGG - Intergenic
1129118594 15:73380891-73380913 AAGGGTCATCCTGTGGTGGAGGG + Intergenic
1129361358 15:75026572-75026594 AAGGCAAATCCTGGGCAGAGAGG + Intronic
1129514815 15:76150946-76150968 CAGAGAAATCCTGGGGTGGGAGG - Intronic
1130033173 15:80333981-80334003 CAGAGGAATGCTGGGGAGGAGGG + Intergenic
1130572647 15:85062227-85062249 ACAGCAAATCCTGGGGAAGACGG - Intronic
1130952950 15:88606290-88606312 AAGGGAAAGAGTGGGGTGGAGGG + Intergenic
1131598845 15:93826923-93826945 AAGGGAAAGCCTTGGCAGCAAGG + Intergenic
1131687010 15:94779120-94779142 GAGGGAAATTCTGTGGAGGGGGG - Intergenic
1132208049 15:99999856-99999878 GAGGGACAACCTGGGGTGGAGGG - Intronic
1132340317 15:101074201-101074223 AAGGAGCAGCCTGGGGAGGAGGG - Intronic
1132671630 16:1104292-1104314 AAGGGAAGGCCTGGGGAGGAAGG + Intergenic
1132789150 16:1675444-1675466 AAGAGGAATGGTGGGGAGGAGGG - Exonic
1133399182 16:5472253-5472275 ATAGGGAAGCCTGGGGAGGAGGG + Intergenic
1133526780 16:6613290-6613312 AAGGGTAAACTTGGGAAGGATGG + Intronic
1133588563 16:7219818-7219840 ATGGGAAATCCTTTGGTGGAAGG - Intronic
1133651309 16:7816367-7816389 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1134153364 16:11822540-11822562 AAGGGAAAAAGTGGGCAGGAGGG - Intergenic
1134648774 16:15891715-15891737 AAGGGAAAGGGCGGGGAGGAAGG - Intergenic
1135174398 16:20215257-20215279 CAGGGTAGTTCTGGGGAGGAGGG + Intergenic
1135242175 16:20817665-20817687 AAGTGAAATACTTAGGAGGATGG - Intronic
1136515152 16:30763599-30763621 GGGAGAAGTCCTGGGGAGGAGGG + Intronic
1136591702 16:31221580-31221602 AAGGGCATTGCTGGGGAGAAGGG + Intronic
1137447384 16:48540074-48540096 AGTGGAAACACTGGGGAGGAAGG + Exonic
1138132236 16:54490416-54490438 AATGGACAACCTGGGGTGGAAGG + Intergenic
1138860254 16:60747310-60747332 AAGGGAAACTCTAGGGAAGAGGG + Intergenic
1139252180 16:65506897-65506919 AGGCAAGATCCTGGGGAGGAAGG - Intergenic
1140937465 16:79687515-79687537 AAGGAAAATCCTACGGAGGAGGG + Intergenic
1141075618 16:81004409-81004431 CAGGGACTGCCTGGGGAGGAAGG + Intronic
1141140177 16:81492469-81492491 AAGGGAGAGCCTGGGCAGAAGGG - Intronic
1141507044 16:84484656-84484678 AAGGCAAATGCTGGGGAGGGTGG - Intronic
1141507190 16:84485545-84485567 AAGGCAAACCCTGGGGATGGTGG + Intronic
1142290667 16:89192489-89192511 AGGGGACGGCCTGGGGAGGAGGG - Intronic
1203019151 16_KI270728v1_random:384235-384257 AAGTGAATTCCTGGGGGTGACGG - Intergenic
1203037486 16_KI270728v1_random:657393-657415 AAGTGAATTCCTGGGGGTGACGG - Intergenic
1142786443 17:2227607-2227629 AAGAGAACTTCTGGGGATGATGG + Intronic
1144764658 17:17725823-17725845 AAGAGAATTCCTGGGGGAGAGGG + Intronic
1145179880 17:20738149-20738171 TAGGGATATCCAGGGGAAGAGGG + Intergenic
1145262956 17:21365567-21365589 CAGGGGAATCCAGGGGTGGATGG - Intergenic
1145266569 17:21382645-21382667 CATGGACATCCAGGGGAGGAGGG - Intronic
1146399872 17:32494129-32494151 AGGGGAGAACCTGGGAAGGATGG + Exonic
1146429131 17:32773996-32774018 AAGGCACAGCCTGGGGAGGAGGG - Intronic
1147044298 17:37742345-37742367 AAGAGAAAGGCAGGGGAGGAAGG - Intronic
1147142518 17:38467258-38467280 AGGGGAACGCCTGGGCAGGAAGG + Exonic
1147546845 17:41408408-41408430 AGGGAAATTACTGGGGAGGATGG - Intergenic
1147702342 17:42404052-42404074 AAGAGAAGCCCTGGGAAGGAGGG - Exonic
1147846464 17:43407352-43407374 ATGAGAAATCCTTTGGAGGAGGG + Intergenic
1147851226 17:43444681-43444703 GAGAGAAAACCTGGGGAGAACGG + Intergenic
1148238947 17:45987488-45987510 AAGTGAAATACTGAGAAGGATGG - Intronic
1148383299 17:47216443-47216465 CAAGGAAATGATGGGGAGGAAGG - Intronic
1148776977 17:50101504-50101526 AAGGCAAAGGCTGGGGAGGAGGG - Intronic
1149462076 17:56836988-56837010 AAGGAAAAACTGGGGGAGGAGGG - Intronic
1149839600 17:59947813-59947835 TAGGGATATCCAGGGGAAGAGGG + Exonic
1150480309 17:65503996-65504018 CAGGGAAAGCCTGGGGATGGAGG + Intergenic
1150774151 17:68065772-68065794 AAGGGAAATCCTGCTGATGTGGG + Intergenic
1152145825 17:78568163-78568185 AAGGAAGATTCTGGGTAGGAAGG - Intronic
1152241912 17:79165410-79165432 CTGGGAAAGCCTGGGAAGGAGGG + Intronic
1152334797 17:79694681-79694703 AAGGAAGCTCCTGGGAAGGATGG - Intergenic
1152668080 17:81583183-81583205 AATAGAATTGCTGGGGAGGAAGG - Intronic
1152727089 17:81952798-81952820 CAGGGAAAGCCGGGGCAGGAGGG + Exonic
1153302590 18:3604309-3604331 AAGGGAATCAGTGGGGAGGAAGG - Intronic
1155203298 18:23536157-23536179 AAGCGAGATCATGGGGAGGCAGG + Intronic
1155239703 18:23853713-23853735 AATGGCAATTCTGGGGAGGCAGG - Intronic
1156187365 18:34678510-34678532 AAGGAAAAGTGTGGGGAGGAGGG - Intronic
1156941532 18:42772820-42772842 AAGGGAAGTCCTGGGGTAGTTGG + Intronic
1157906492 18:51574117-51574139 GAGGGGCAGCCTGGGGAGGAGGG + Intergenic
1158498838 18:57982219-57982241 AAGGGAAAGCTCGGGGAAGAGGG + Intergenic
1159164377 18:64683296-64683318 AAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1159943354 18:74425826-74425848 AGGGGTATTCCCGGGGAGGAGGG - Intergenic
1160739059 19:677536-677558 AAGGGACCTCCTGGGGTGGGTGG + Intronic
1161012773 19:1968307-1968329 CAGGGGCAGCCTGGGGAGGAGGG - Intronic
1161012794 19:1968368-1968390 TCGGGACAGCCTGGGGAGGAGGG - Intronic
1161176755 19:2847972-2847994 TAGGTAAACCCTGGGGAGGCAGG - Intronic
1161404306 19:4083092-4083114 AGGAGAAGTCCTGGGAAGGAGGG - Intergenic
1161711940 19:5853738-5853760 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1161821735 19:6534131-6534153 AAGGGGACTCCTGGAGAGGGCGG - Intronic
1162590970 19:11591101-11591123 AAAGGAATTCCTGAGGTGGAAGG + Intronic
1163548698 19:17953213-17953235 AAAGGAAATCCCTGGGGGGAGGG + Intronic
1164933858 19:32196268-32196290 ACGGGAGATCCTGGAGTGGATGG - Intergenic
1165124336 19:33583276-33583298 AAGGGAATTCCCAGGGAAGAAGG - Intergenic
1166317301 19:41996355-41996377 ATGGGGAAGCCTGGGGAGGTGGG + Intronic
1166411987 19:42561618-42561640 CTGGGATCTCCTGGGGAGGATGG - Intergenic
1166452998 19:42917654-42917676 ATGGGGTATCCTGGAGAGGATGG - Intronic
1166685352 19:44793293-44793315 GAGGGAAATGCTGGGAGGGAAGG - Intronic
1167594454 19:50419722-50419744 TATGCAAATTCTGGGGAGGAGGG + Intronic
1167597646 19:50435865-50435887 GAGGGGAACCCGGGGGAGGAGGG + Intronic
1167611869 19:50511636-50511658 AAGGGAGACCCTGGGGAAGTGGG + Exonic
1167902059 19:52629437-52629459 AAGGAGCAGCCTGGGGAGGAGGG - Intronic
1168713499 19:58514503-58514525 AAGGGAGGTCCTGGAGAGGAGGG - Intronic
926115094 2:10207968-10207990 AAGGGAAATTCTAGGGTGGCAGG - Intronic
926122348 2:10250833-10250855 AAAGGAAATCCTCAGGATGATGG - Intergenic
926296187 2:11570628-11570650 AAGGGTAAAACTAGGGAGGAAGG - Intronic
926737307 2:16083297-16083319 GAGGGGCTTCCTGGGGAGGAAGG - Intergenic
926822147 2:16864044-16864066 GAGAGAAATCCTGGGTAGGCGGG + Intergenic
927925399 2:27009736-27009758 AGGGGAATGCATGGGGAGGAAGG - Intronic
928189915 2:29154631-29154653 CAGGGAAATCATAGAGAGGAGGG + Intronic
928366531 2:30707145-30707167 AAGTGACAGCCTGAGGAGGAGGG + Intergenic
928778211 2:34791363-34791385 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
928876746 2:36048932-36048954 TAGGGGAATACTGGAGAGGAAGG + Intergenic
929081986 2:38130140-38130162 AAGGGAACTCCTGGAGACGTAGG + Intergenic
929532010 2:42758693-42758715 AAGAAAAATACTGGGGAGGAGGG - Intergenic
930250031 2:49024686-49024708 AAGAGAAAGGCAGGGGAGGAGGG - Intronic
931404205 2:61960760-61960782 AAGGGAAAGGCACGGGAGGAAGG - Intronic
931618533 2:64186623-64186645 AAGAGAAAGTCTTGGGAGGAGGG + Intergenic
931625164 2:64250719-64250741 ATGGGAAAGCCGGGGGAGGAAGG + Intergenic
932306400 2:70706566-70706588 GAGGCAGAGCCTGGGGAGGAGGG + Intronic
932854298 2:75217834-75217856 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
933134053 2:78709573-78709595 AAGGGAAATTCAGTGGAGAATGG + Intergenic
933232978 2:79830340-79830362 AAGGGAAGTTCTGGGGAGGATGG + Intronic
933352972 2:81178709-81178731 CAGGGAAATACTGGGGAGAAGGG - Intergenic
933719659 2:85389956-85389978 AAGGGATGTCCTGGGGAGACCGG - Intronic
933977389 2:87522492-87522514 GAGAGAAATGGTGGGGAGGAAGG - Intergenic
934622891 2:95826340-95826362 CACTGAACTCCTGGGGAGGAAGG - Intergenic
934810879 2:97275763-97275785 CACTGAACTCCTGGGGAGGAAGG + Intergenic
934826813 2:97432176-97432198 CACTGAACTCCTGGGGAGGAAGG - Intergenic
935206132 2:100897685-100897707 AAGGTGAATCCTGGGTGGGACGG - Intronic
936316434 2:111428313-111428335 GAGAGAAATGGTGGGGAGGAAGG + Intergenic
936725524 2:115310531-115310553 AAGGGAGCTACTAGGGAGGAAGG + Intronic
937340340 2:121087062-121087084 AAGGAAACTCCTGGGGAACATGG - Intergenic
937879601 2:126855679-126855701 AAGGGAACCCCTGGGGGAGAGGG - Intergenic
937988073 2:127647570-127647592 GAGGGACAGCCTGGGGTGGAGGG + Intronic
938030100 2:127984949-127984971 CAGGCAAATCCTGGGGGCGAAGG - Intronic
939460826 2:142493913-142493935 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
940182844 2:150954687-150954709 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
940675895 2:156724113-156724135 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
940833842 2:158498620-158498642 AAGAAATATCCTGGGGAAGATGG - Intronic
941384774 2:164840796-164840818 AAGTGAGCTCCTGGGGAGGGAGG - Intronic
942212284 2:173683435-173683457 AAGGGAAGTGGTGGGGAGGCAGG + Intergenic
942445405 2:176074236-176074258 GACGGAAACCCAGGGGAGGAGGG - Intergenic
942822376 2:180129866-180129888 AAAGGAAATCCTGAGGAGAGGGG + Intergenic
943061488 2:183045538-183045560 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
943384552 2:187185064-187185086 CAGGGAAATTCTGGGCAGAAAGG - Intergenic
943483072 2:188446252-188446274 AAGAGTAATCATGTGGAGGATGG + Intronic
943531263 2:189084000-189084022 AATGGAAATCCTGGTGAAGTGGG - Exonic
943678522 2:190742566-190742588 AAGGAAAATCCAGGGGAACATGG + Intergenic
944097547 2:195985897-195985919 AAAGGAAAGGCTGGGGATGAAGG - Intronic
944394046 2:199248592-199248614 AAGGAGCAGCCTGGGGAGGAAGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944841914 2:203632559-203632581 AATAGAAATGTTGGGGAGGAGGG - Intergenic
945277211 2:208000037-208000059 AAAGGAAATTCTGGGGAAAATGG + Intronic
945580617 2:211590562-211590584 AGGTGAAATCGTGGGGAGGGGGG - Intronic
946832773 2:223742884-223742906 AATGGAGAGCATGGGGAGGATGG - Intergenic
947144744 2:227054638-227054660 AAGGGAGAACCTGGAGAGAAGGG - Exonic
947214353 2:227736449-227736471 GAGGGCATTCCTTGGGAGGAGGG + Intergenic
947642418 2:231714429-231714451 AGGGGAGATGCTGGGAAGGAGGG + Intergenic
947705613 2:232273168-232273190 CAGGGAAACCCTAGGAAGGAGGG - Intronic
947822716 2:233083205-233083227 AAGGAAGCTGCTGGGGAGGAGGG + Intronic
948763023 2:240204283-240204305 AAGGGAAATGCTGAGAGGGAAGG - Intergenic
948896925 2:240931918-240931940 AAGGTGCATCCTGGGAAGGAAGG + Intronic
1168975484 20:1962514-1962536 AAGGGGAAGCCTGGGGGGGTTGG + Intergenic
1169291795 20:4359222-4359244 CAGGGAGACCCTGGGGAGCAGGG - Intergenic
1169671503 20:8107502-8107524 ATGGGAAATACTGGGGAAGGAGG - Intergenic
1169850914 20:10049714-10049736 ATGAGAAAACCCGGGGAGGAGGG + Exonic
1170478566 20:16742619-16742641 AAGGGAAATTTTGGGGGTGATGG - Intergenic
1171157825 20:22892640-22892662 AAAGGAAATCCTGAGTAGAATGG + Intergenic
1171372065 20:24668592-24668614 GCGGGTATTCCTGGGGAGGAGGG - Intergenic
1171461561 20:25300865-25300887 TAGGGAATTCCTGGGGAAGTCGG - Intronic
1172221281 20:33276726-33276748 CAGGGACAGCCTGAGGAGGAGGG + Intronic
1173662644 20:44745241-44745263 AAGTGATATCCTAGTGAGGAGGG - Intergenic
1173681120 20:44882867-44882889 AGGGGAAATTGTGTGGAGGAGGG + Intergenic
1174173627 20:48631839-48631861 AAGAGAACCCCAGGGGAGGAGGG - Intronic
1174419348 20:50389657-50389679 AAGGGAAGGCCTGGTCAGGAGGG - Intergenic
1175194483 20:57233473-57233495 AGGGGAAATTCTGGGCTGGAAGG + Intronic
1175203480 20:57293212-57293234 AAGGGAATGCCTGGGGGAGAGGG + Intergenic
1175228931 20:57461306-57461328 AGGGGAACTCCGGGGGAGGCTGG + Intergenic
1175252308 20:57616900-57616922 GAGGGCACTCCCGGGGAGGATGG - Intronic
1175315640 20:58044781-58044803 AGGGGAAATGATGGAGAGGAAGG + Intergenic
1175806454 20:61831829-61831851 AAGGCAAATGCTGGAGAGGCTGG - Intronic
1177904787 21:26962302-26962324 AAGCTAAATCCTGGGGAGATTGG + Intronic
1178097867 21:29234859-29234881 CAGGGAAATACTGGGTAGAAGGG - Intronic
1178596508 21:33958121-33958143 AGGGGAAATGCTGGAGAAGAGGG + Intergenic
1178668803 21:34572394-34572416 AAGGGACATCCTGGGGCTGGTGG + Intronic
1178820033 21:35966658-35966680 AAGTGCAATCCTGGGGAAGCAGG + Intronic
1179527004 21:41985662-41985684 AAGGGCTCTCCTGTGGAGGACGG + Intergenic
1179616000 21:42583828-42583850 AAGGGAAGTCCAGGGGACAATGG - Intergenic
1179778292 21:43682322-43682344 AGGGCAAGGCCTGGGGAGGATGG - Intronic
1180081983 21:45491222-45491244 CAGGGAGATCCAGGGAAGGACGG + Exonic
1180700060 22:17776360-17776382 CAGGGAAATTCCGGGGATGATGG + Intergenic
1181359503 22:22323673-22323695 AAGAGAAAGCCAGGGGAGGCTGG - Intergenic
1181534344 22:23533977-23533999 AAGGGCAGGGCTGGGGAGGAGGG + Intergenic
1181536582 22:23549413-23549435 AGGGGAAAACCAGGGGAGGGTGG - Intergenic
1182248525 22:28980479-28980501 AAGGGATATTTTGGGAAGGAAGG - Intronic
1182495618 22:30705264-30705286 AACAAAAATACTGGGGAGGAAGG - Intronic
1182519783 22:30878809-30878831 ATGGGAAAACCTGGGGAGGAAGG + Intronic
1183005111 22:34894828-34894850 AGTGGAAATTCTGGGGATGAGGG - Intergenic
1183268696 22:36847290-36847312 AATGGAGGTCCTGGGGATGAGGG - Intergenic
1183715390 22:39530253-39530275 AGGGGAATTCCAGGGGTGGAGGG + Intronic
1184256990 22:43292966-43292988 CTGGGGAAGCCTGGGGAGGAGGG + Intronic
1184277948 22:43420971-43420993 AATGGAACTACGGGGGAGGATGG - Intronic
1184413526 22:44339139-44339161 CAGGGAAACACTGGGGAGGGGGG - Intergenic
1184584032 22:45435645-45435667 GAGGGAAATCCTTGGGAAGAAGG + Intergenic
949493305 3:4609587-4609609 ATGGGAAATGCTGGGATGGAGGG + Intronic
951078725 3:18425862-18425884 AAGGAAAATGACGGGGAGGAGGG + Intronic
951762893 3:26164440-26164462 GAGGGGCAGCCTGGGGAGGAGGG + Intergenic
951889081 3:27552208-27552230 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
952085448 3:29815004-29815026 AAAAGACATCCTGAGGAGGAGGG + Intronic
952088025 3:29850154-29850176 AGAAGTAATCCTGGGGAGGAGGG + Intronic
952882052 3:37991367-37991389 AAGGAAAGACCTGGGGAGGAGGG + Intronic
953094615 3:39762665-39762687 AAGAGAAACCCTGGAGAGGTGGG + Intergenic
953258921 3:41318660-41318682 GAGGGAAATCCTGATGAGCAGGG + Intronic
953466000 3:43120042-43120064 AATGAAAATCATGGGGAGGGAGG - Intergenic
953536600 3:43781866-43781888 ATGGGAAATTCTGGAGAGGTAGG - Intergenic
953599537 3:44349075-44349097 AAGGAGCAGCCTGGGGAGGAGGG + Intronic
953841262 3:46391817-46391839 GAGGAACAGCCTGGGGAGGAGGG + Intergenic
954134976 3:48578346-48578368 CAGGGAAAGCCAGGCGAGGATGG - Exonic
954135552 3:48580588-48580610 CAGGGAGATCCTGGAGAGGATGG - Exonic
954197372 3:49004737-49004759 AAGGGACTTCCAGGGGAGGTGGG + Intronic
954306023 3:49725879-49725901 AAGGCAACACCTGTGGAGGAAGG + Exonic
954422494 3:50426038-50426060 AGGGGAAGGCCAGGGGAGGAAGG - Intronic
954969354 3:54638527-54638549 AAGGAGCAGCCTGGGGAGGAAGG + Intronic
954970269 3:54646079-54646101 AAGGGATATCCTGGGTGGGCAGG + Intronic
954981638 3:54751224-54751246 AAGGGGATTTCTGGGGTGGATGG - Intronic
955192403 3:56773625-56773647 AGGGGAAATTCTAGGTAGGATGG + Intronic
956995597 3:74823980-74824002 AAGGGAAGGCCTGGGGCTGAAGG + Intergenic
958676911 3:97277030-97277052 AAGGAGCAGCCTGGGGAGGAGGG + Intronic
959845692 3:111030551-111030573 TAGGGAAAAACTGGGGAGGTAGG + Intergenic
962012379 3:131404623-131404645 TAGGGAAAGGCTGGGGAGAAAGG - Intergenic
962049366 3:131796606-131796628 AAGGGGGACCCTGGGGAGGAGGG - Intronic
962375596 3:134856262-134856284 AAGGGACTTCATGGGGAGCAAGG + Intronic
962479698 3:135787739-135787761 AAGAGTCAGCCTGGGGAGGAGGG - Intergenic
962580478 3:136793196-136793218 AAGGGAAGCCCTGCTGAGGATGG + Intergenic
963319641 3:143798913-143798935 AAGGAGCAGCCTGGGGAGGAGGG - Intronic
963425124 3:145114611-145114633 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
963468524 3:145712030-145712052 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
964670271 3:159217719-159217741 AATGGAGAAACTGGGGAGGAGGG - Intronic
964983551 3:162714045-162714067 AAGGAACAGCCTGGGGAAGAGGG - Intergenic
965383838 3:168022566-168022588 AAGGGAAGACCTGGGAACGATGG + Intronic
966398541 3:179524988-179525010 GAGGAACAGCCTGGGGAGGAGGG + Intergenic
966593895 3:181710233-181710255 AAGGGTAGACCAGGGGAGGAGGG + Intergenic
966594575 3:181713585-181713607 CAGAGAAAACCTGGGGAGGGTGG + Exonic
967321475 3:188199187-188199209 AAGGGCAAGCCTTGAGAGGAAGG + Intronic
967517413 3:190386694-190386716 AAGGGAAATTCTGGATAGCAGGG + Intronic
968348301 3:198030396-198030418 AAACGAAATACTGGGGAGAACGG - Intronic
968496171 4:917646-917668 AAGGGTTACCGTGGGGAGGAGGG + Intronic
968691375 4:1992076-1992098 GTGGGAAATCCTGGGGATGAGGG + Intronic
968864002 4:3196057-3196079 CAGGGAAACCCTTGGAAGGAGGG + Intronic
968902210 4:3437060-3437082 CAGGGAAATGCTGGGCAAGAAGG + Intronic
969283894 4:6190563-6190585 AAGGAGAGGCCTGGGGAGGAAGG + Intronic
970600104 4:17635205-17635227 AAGGAAAGTCCAGGGGAGGAAGG + Intronic
972313054 4:37899270-37899292 AAAAGAAATTCTGGGAAGGAGGG + Intronic
972515958 4:39810852-39810874 AATGGAAAGCCTGGGTAGCATGG - Intergenic
972594324 4:40516730-40516752 AAGGGAAATCCTGGGCTGTCAGG - Intronic
973030610 4:45332783-45332805 AATGGAATCCCTGGGGAGGGGGG + Intergenic
975708718 4:77137326-77137348 AATGGAAAGTCTGGGGAGGCCGG + Intergenic
976740050 4:88347805-88347827 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
977013017 4:91658671-91658693 GAGGAACAGCCTGGGGAGGAAGG + Intergenic
977782536 4:100995862-100995884 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
978074250 4:104509214-104509236 AAGGCAAATTCTGAGGTGGAGGG + Intergenic
978611600 4:110546737-110546759 AAGGGAAGTCCATGAGAGGATGG - Intronic
979054715 4:115979702-115979724 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
979499041 4:121418269-121418291 CAGGGAAAGCCTGGGGCTGAAGG + Intergenic
979798391 4:124876064-124876086 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
979850398 4:125565684-125565706 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
980506429 4:133730134-133730156 AAGGTAACTGCTGAGGAGGATGG - Intergenic
980871403 4:138615434-138615456 CAGGGAAATACTGGGTAGAAGGG + Intergenic
981815915 4:148830201-148830223 CAGGGAAATACTGGGTAGAAGGG - Intergenic
983100095 4:163614927-163614949 AAGGGAAACCCTGAGGAAGGTGG + Intronic
983360322 4:166717962-166717984 AAGGAGCAGCCTGGGGAGGAAGG - Intergenic
985079101 4:186246216-186246238 AAGGAGCAGCCTGGGGAGGAGGG + Intronic
985703825 5:1389299-1389321 TAGGGAAGACCTGGGGAGAATGG + Intergenic
985745420 5:1644044-1644066 ATGGGAAACCCTGGGGAGGGAGG + Intergenic
986300791 5:6476957-6476979 GTGGGCCATCCTGGGGAGGATGG - Intronic
986412234 5:7492624-7492646 AAGTTAAACACTGGGGAGGAAGG + Intronic
986719602 5:10551620-10551642 AATGGAATTCCTAGGGAGGAAGG - Intergenic
987312891 5:16697836-16697858 AAGAGGAGACCTGGGGAGGAAGG + Intronic
988437480 5:31193542-31193564 AAGGGAAAGCCTGGGGCTGAAGG + Intergenic
990793772 5:59516275-59516297 AAGTGACTGCCTGGGGAGGAGGG - Intronic
991271952 5:64794582-64794604 AAGGGAAATGGTGGGGAAGACGG + Intronic
991560020 5:67940864-67940886 AAGAGAAATCCTGTGGAGGAAGG + Intergenic
991966911 5:72101758-72101780 AAGGGAAAGCCTGTGTTGGAGGG + Intergenic
992202882 5:74401490-74401512 AAGGAAGCTCTTGGGGAGGATGG - Intergenic
992603247 5:78426679-78426701 CAGGGAAATTTTGGGAAGGATGG - Intronic
993192625 5:84700143-84700165 AAGGAGCAGCCTGGGGAGGAAGG - Intergenic
993327788 5:86563911-86563933 AAGAGAACTTCTGGAGAGGAGGG + Intergenic
993774021 5:91968655-91968677 AAGGGCAATTCTGTGGAGAAGGG + Intergenic
993808707 5:92445792-92445814 AAGGGAAAAACAGAGGAGGAGGG - Intergenic
994059300 5:95456301-95456323 ACTGGAATTACTGGGGAGGAAGG + Intergenic
994615196 5:102095655-102095677 AAGAGAAACCATGTGGAGGAGGG - Intergenic
994641731 5:102419120-102419142 AAGGCAAACCATGGAGAGGAGGG - Intronic
996163974 5:120201970-120201992 AGGGGAAATCCTACAGAGGAAGG - Intergenic
996375497 5:122802357-122802379 GAGGGAAATGATGGGGAGGAGGG + Intronic
996734756 5:126748397-126748419 AAGGGAAATCCTGGTGGGCTGGG - Intergenic
997403104 5:133617660-133617682 AAGGAAAATCCTAGGGAAGCAGG - Intergenic
998717069 5:144896503-144896525 AAGAGAAATGCTTGAGAGGATGG + Intergenic
998869771 5:146540664-146540686 ATGGGAATTCCTGGGGTGAAAGG + Intergenic
998995298 5:147864937-147864959 AAGGAGCAGCCTGGGGAGGAAGG - Intergenic
999063592 5:148661031-148661053 AAAGGAAGCCCTGAGGAGGAAGG + Intronic
999232278 5:150068732-150068754 AGGGGAAATGCAGGAGAGGAAGG - Intronic
999429081 5:151510689-151510711 AAGGGAAATGCTGGGAGGGGTGG + Intronic
1000034179 5:157430690-157430712 AAGAAAATCCCTGGGGAGGATGG + Intronic
1001298377 5:170515338-170515360 AAGGGAAAAACCAGGGAGGAGGG - Intronic
1001304352 5:170560891-170560913 GAGGGAGAATCTGGGGAGGAAGG - Intronic
1001648632 5:173299923-173299945 ACGGGCAATCCTGGGGAAAAAGG - Intergenic
1002038462 5:176492181-176492203 AAGAGCAAACCTGGGGAGGAAGG - Exonic
1002112832 5:176931443-176931465 AAGAGAAATCCTGAGGTGGGGGG + Intronic
1002138320 5:177122416-177122438 AAGGCAGGTTCTGGGGAGGAGGG - Intergenic
1002533700 5:179864575-179864597 GAGGGGGATCCTGGGGAGGGGGG + Intronic
1002966733 6:1974074-1974096 AAGAGAAATCGAGGTGAGGAAGG - Intronic
1003430260 6:6031830-6031852 AAGGAGCAGCCTGGGGAGGAAGG + Intergenic
1005750254 6:28875604-28875626 AGGGGGAATCCTGGGGTGGTCGG - Intergenic
1006002728 6:30978281-30978303 AAAGAAAATCTTGGGGAAGAAGG + Intergenic
1006133211 6:31880922-31880944 AAATGGAAACCTGGGGAGGAGGG - Intronic
1006275617 6:33003094-33003116 TAGGTAAATCCTGACGAGGATGG + Intergenic
1007485706 6:42179207-42179229 AAAGGGAATCAGGGGGAGGAGGG - Intronic
1008190790 6:48454323-48454345 AAGGAAAATGCTTGAGAGGATGG - Intergenic
1008476425 6:51939809-51939831 AAGGAGCAGCCTGGGGAGGAGGG - Intronic
1008492671 6:52102571-52102593 GAGGGTAATTCTTGGGAGGAGGG - Intergenic
1008545029 6:52576775-52576797 AGGTGAGAGCCTGGGGAGGAGGG - Exonic
1008885585 6:56429309-56429331 AAGTGAATTTCTGGGGAGGCTGG - Intergenic
1009269722 6:61601728-61601750 TAGGAACAGCCTGGGGAGGAGGG - Intergenic
1009973267 6:70646954-70646976 AAGTGAAATCCAGGGGACAATGG + Intergenic
1010071819 6:71752627-71752649 GAGGGGCAGCCTGGGGAGGAGGG + Intergenic
1011640824 6:89414279-89414301 AAAGGAAACCCCAGGGAGGAGGG + Intergenic
1012330405 6:97978842-97978864 AAGGGAAGTTCTGGAGAGAAAGG + Intergenic
1012347360 6:98207320-98207342 GAGGGAAATCCTGGTGGAGATGG - Intergenic
1013082057 6:106821635-106821657 AAGGGATATTCTGGGGAGGCGGG - Intergenic
1013139010 6:107312243-107312265 AAGGGTATTTCTGGGGAGGATGG - Intronic
1013253506 6:108359397-108359419 AAGGGAGATCCAGGGGAGACAGG + Intronic
1013609271 6:111778994-111779016 CAGGGAAACCCTTGTGAGGAGGG - Intronic
1016633128 6:146255525-146255547 AAGAGAAATCTCAGGGAGGAAGG - Intronic
1016645753 6:146406445-146406467 GAGGGAAAGCCTGGAAAGGAAGG + Intronic
1017184266 6:151585147-151585169 AGAGGAACTCCTGGGAAGGATGG + Intronic
1017723961 6:157264029-157264051 AAGAGAAAGCTTTGGGAGGAGGG - Intergenic
1017954481 6:159167549-159167571 AAGAGAAATCCAGGTGAGGACGG - Intergenic
1017970324 6:159306808-159306830 GAAAGAAATCCTGGGGTGGAGGG - Intergenic
1018471679 6:164102721-164102743 AAGAGACCACCTGGGGAGGAGGG - Intergenic
1019172664 6:170142775-170142797 TAGGGAGATCCTGGGGACGGGGG - Intergenic
1019233494 6:170588077-170588099 AAGAGAAAATTTGGGGAGGAAGG + Intergenic
1019501548 7:1367247-1367269 CAGGGGATTCCTGGGAAGGAGGG - Intergenic
1019584308 7:1789054-1789076 AAGCAGAATCCTGGGGAGGAGGG + Intergenic
1020008983 7:4798403-4798425 CAGAGAAACCCTGGGGAAGAGGG - Intronic
1021263113 7:18483514-18483536 TAGGAAAATCCTGGGAAAGAGGG + Intronic
1021459400 7:20868987-20869009 ATGGGTAATCCTGGTGGGGAAGG - Intergenic
1021841782 7:24726849-24726871 AATGGAAACCCTGGGGAGCCTGG + Intronic
1022315548 7:29241663-29241685 AAGGGCAAAGCTGGGCAGGAGGG + Intronic
1022848644 7:34237035-34237057 CAAGGAAAGCCTTGGGAGGATGG + Intergenic
1024316157 7:48018691-48018713 CAGGCAAACCCTGGGGAAGAGGG + Intronic
1024568431 7:50703975-50703997 AAAGGAAATGCTGGGGAAGCTGG - Intronic
1024697531 7:51871679-51871701 GAGGAACAACCTGGGGAGGAAGG - Intergenic
1024926710 7:54623461-54623483 AAAGCAAATCCTGAGGAAGAGGG + Intergenic
1025251600 7:57354826-57354848 AAGGGAAGGCCTGGTCAGGAGGG + Intergenic
1025297395 7:57786925-57786947 AAGGGTAAACCTGGGGTGGGGGG - Intergenic
1026192922 7:68146029-68146051 AAGGGAGATGCTGGGGAGGTTGG + Intergenic
1026828316 7:73597140-73597162 AGAGGAAAGCCTGGGGAGGGAGG - Intronic
1028506105 7:91571816-91571838 AAGGGAAGTCCTTGGGGGTATGG + Intergenic
1029222331 7:99000478-99000500 GAGGGAAACACTGTGGAGGAGGG - Intronic
1029261421 7:99305311-99305333 TAAGGACATTCTGGGGAGGAAGG - Intergenic
1029380903 7:100213927-100213949 GAGGGTAACCCAGGGGAGGATGG + Intronic
1030133079 7:106219576-106219598 AAGTGAAATCTTGGGGAGGAAGG - Intergenic
1031332463 7:120482673-120482695 AAGGGTCATCCTGTGGTGGAAGG - Intronic
1031525503 7:122818582-122818604 AAGGAGCAGCCTGGGGAGGAAGG - Intronic
1031689047 7:124765712-124765734 GAAGGAAATCGTGGGGAGAAGGG + Intergenic
1032055937 7:128684251-128684273 AAAAGAAATCCTGAGAAGGATGG + Exonic
1032603122 7:133321110-133321132 TAGGGAATCCCTGGGGAGTATGG + Intronic
1032834827 7:135662758-135662780 AAGGGATTTTCTGGGGAGGCAGG - Intronic
1032978989 7:137259803-137259825 AAAAGAAATACTGGGGATGAAGG - Intronic
1032994775 7:137432815-137432837 CAGGGAAATATTGGGAAGGAAGG - Intronic
1033625485 7:143106477-143106499 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1033734905 7:144212509-144212531 AAGGGGAAGCCTGGGAATGAAGG - Intergenic
1033748150 7:144338460-144338482 AAGGGGAAGCCTGGGAATGAAGG + Intergenic
1034408942 7:150927636-150927658 AAGGCAAATCCATGGGAGGGCGG - Intergenic
1034415051 7:150959854-150959876 ACGGGAGATCCCGGAGAGGAAGG - Intronic
1034452774 7:151146292-151146314 AAGAGAACACCTGGGCAGGAAGG - Intergenic
1035677064 8:1463441-1463463 AAGGGAGTTCCTGGGGAGCATGG - Intergenic
1036114069 8:5939554-5939576 AAGAGAAATTCTGGGATGGAAGG + Intergenic
1037520331 8:19674721-19674743 AAGGGAAATAATTGGGAGCAGGG + Intronic
1037647820 8:20809859-20809881 GAGGGAGATAATGGGGAGGAAGG - Intergenic
1039231323 8:35451874-35451896 AAGGGAAAGCCTTGAAAGGAGGG + Intronic
1039404821 8:37303486-37303508 AACGGAAATCCAGGGGTGGGAGG + Intergenic
1039433648 8:37545131-37545153 AAGGGGAAGGGTGGGGAGGAAGG + Intergenic
1041460819 8:58109560-58109582 TATGGAAATTCTGGGGAGGAAGG + Intronic
1041738049 8:61132314-61132336 CAGGGGAATCCTGGAGATGAGGG + Intronic
1043540376 8:81255662-81255684 AAGGAAAAACTTGGGGAGGAAGG + Intergenic
1043858668 8:85290216-85290238 GTTAGAAATCCTGGGGAGGATGG - Intergenic
1043885030 8:85589099-85589121 AAGTCAAACCCTGGGCAGGATGG - Intergenic
1045222669 8:100213640-100213662 AAGGGAAAACCCGGCGGGGACGG - Intronic
1046074799 8:109302471-109302493 GAGGCACAGCCTGGGGAGGAGGG - Intronic
1049310437 8:141931257-141931279 AAGGAGAGGCCTGGGGAGGAGGG + Intergenic
1049337293 8:142093305-142093327 AAGGGAAAGCCTGGGGCTGTGGG + Intergenic
1049400924 8:142426872-142426894 AAAGGAAATCTGGGAGAGGAGGG - Intergenic
1049700891 8:144011962-144011984 AAGGGGCATCCTGGCCAGGAAGG + Intronic
1049754929 8:144306716-144306738 ATGACAAATCCTGGGGAGGTGGG - Intronic
1049825170 8:144663089-144663111 AAGGGGGATAATGGGGAGGAGGG - Intergenic
1050005772 9:1128830-1128852 TAGGGAAATCCTAGGGATGGTGG - Intergenic
1050347600 9:4707853-4707875 CAGGCAAATCCTGGGAAAGAAGG - Exonic
1051328489 9:15998684-15998706 AAGGACAATCCTGGGTAGCAGGG - Intronic
1051365017 9:16315858-16315880 AAGGGTCATTCTGGGAAGGACGG + Intergenic
1052653236 9:31328041-31328063 AAGGGGTAGCCTGGGGAGGAGGG - Intergenic
1052835021 9:33244050-33244072 AAGGGCTATCCTGGGGCTGAGGG - Intronic
1053332505 9:37227558-37227580 AATGGAACTCCTGGGTTGGATGG - Intronic
1054986748 9:71270570-71270592 AAGTGAATACCTAGGGAGGAGGG - Intronic
1056217062 9:84415305-84415327 AAGGGAAATGAAAGGGAGGATGG - Intergenic
1056567545 9:87787880-87787902 AATGGAAATGCTGGGGCGGAGGG - Intergenic
1057695218 9:97318313-97318335 GAGGCAAAGTCTGGGGAGGAAGG + Intronic
1058449561 9:105083489-105083511 AAGGAAATTCCTCGTGAGGAAGG + Intergenic
1058481682 9:105402251-105402273 AAGAGAAAGACTTGGGAGGAAGG + Intronic
1059633517 9:116150722-116150744 AAGGGAGTCCCTGGGGAGGAGGG + Intergenic
1060433553 9:123572116-123572138 AAGGGAAATTTGGGGGATGATGG - Intronic
1060932219 9:127496293-127496315 CTGGGAAATCCTGGGGAGGTGGG + Intronic
1060989377 9:127839347-127839369 TAGGGGATGCCTGGGGAGGAAGG + Intronic
1061006180 9:127929570-127929592 GAGGGATATCAAGGGGAGGAAGG - Intronic
1061083032 9:128383531-128383553 AAGGGCCATCCTGGGGAAGAGGG + Intronic
1061490555 9:130941665-130941687 AAGGGAAATCCGAGGGTGGAGGG - Intergenic
1062090347 9:134674471-134674493 AAGGGAACTCCTGGGGGTGATGG + Intronic
1062227306 9:135460085-135460107 AAGGGAGCCCCTGGGAAGGAGGG + Intergenic
1185780497 X:2840220-2840242 CAGAGAAACCCTGGTGAGGACGG + Intronic
1186783971 X:12941455-12941477 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1187440588 X:19314579-19314601 AAGGAAAAATATGGGGAGGAAGG - Intergenic
1188514394 X:30969416-30969438 AAGAGAAACCCTGAGGAGTATGG - Intronic
1188570820 X:31583409-31583431 AGGTGAAAACCTGGGGAAGAGGG + Intronic
1189651436 X:43194013-43194035 AAAGGAAAACCAGGGGAGAATGG - Intergenic
1189920387 X:45897383-45897405 AAAGGAAGTCCTGGGGTGAAGGG + Intergenic
1190739859 X:53281586-53281608 TAGGGAAGGGCTGGGGAGGAGGG - Intronic
1190752137 X:53371998-53372020 AAGGGAATTTGGGGGGAGGAGGG - Intergenic
1191014295 X:55792359-55792381 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1192454491 X:71265834-71265856 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1192914234 X:75636345-75636367 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1192986953 X:76409800-76409822 AAGGGAAGTCCTGGGGAAGATGG + Intergenic
1193885844 X:86983468-86983490 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic
1193941403 X:87683554-87683576 GAGGAGAAGCCTGGGGAGGAAGG - Intergenic
1194045655 X:88998704-88998726 AAGGCAAAGCGTGGGGTGGAAGG + Intergenic
1194351197 X:92826164-92826186 AAGGAGCAGCCTGGGGAGGAAGG - Intergenic
1195017051 X:100790503-100790525 AAGGAGCAGCCTGGGGAGGAGGG + Intergenic
1195112365 X:101660224-101660246 AAGGAAAATCCTGGGGACTAGGG - Intergenic
1195524366 X:105869482-105869504 AAGGGAAATGCCAAGGAGGAGGG - Intronic
1195986283 X:110634154-110634176 AAGGGAAATCAGGGGGTGGAGGG + Intergenic
1196203107 X:112908580-112908602 AAGGGAAAACTTGGTGTGGATGG + Intergenic
1196585017 X:117419290-117419312 AAGGGGCAGCCTGGGGAGAAGGG - Intergenic
1196736079 X:118982048-118982070 GAGGAACATCCTGGGGAAGAAGG - Intronic
1197291718 X:124666584-124666606 TAGGGAAATCATGGGAAAGAAGG - Intronic
1197820807 X:130538992-130539014 AGGGGAAAGCCTGGGTAGGGGGG + Intergenic
1198155292 X:133954157-133954179 AAGGGAGATGGTGGGCAGGAGGG + Intronic
1198631307 X:138641764-138641786 AAGGGAGAGACTGGGGAAGAGGG + Intronic
1199321172 X:146440990-146441012 AAGAGAAAACAGGGGGAGGAAGG + Intergenic
1199998731 X:153045062-153045084 AAGAGAAATTCAGGGGAGGTGGG + Intergenic
1201581301 Y:15514030-15514052 AAGGAGCAGCCTGGGGAGGAGGG - Intergenic