ID: 1070605843

View in Genome Browser
Species Human (GRCh38)
Location 10:77898134-77898156
Sequence CATCAGCGCAGGTGACCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605834_1070605843 17 Left 1070605834 10:77898094-77898116 CCACAAGCACCTTCCTCCCAGGA 0: 1
1: 0
2: 2
3: 42
4: 357
Right 1070605843 10:77898134-77898156 CATCAGCGCAGGTGACCAAGTGG No data
1070605836_1070605843 4 Left 1070605836 10:77898107-77898129 CCTCCCAGGAGCCAGAACAGCCT 0: 1
1: 0
2: 4
3: 36
4: 269
Right 1070605843 10:77898134-77898156 CATCAGCGCAGGTGACCAAGTGG No data
1070605837_1070605843 1 Left 1070605837 10:77898110-77898132 CCCAGGAGCCAGAACAGCCTTCT 0: 1
1: 0
2: 0
3: 27
4: 228
Right 1070605843 10:77898134-77898156 CATCAGCGCAGGTGACCAAGTGG No data
1070605839_1070605843 -7 Left 1070605839 10:77898118-77898140 CCAGAACAGCCTTCTCCATCAGC No data
Right 1070605843 10:77898134-77898156 CATCAGCGCAGGTGACCAAGTGG No data
1070605838_1070605843 0 Left 1070605838 10:77898111-77898133 CCAGGAGCCAGAACAGCCTTCTC 0: 1
1: 0
2: 2
3: 36
4: 263
Right 1070605843 10:77898134-77898156 CATCAGCGCAGGTGACCAAGTGG No data
1070605835_1070605843 8 Left 1070605835 10:77898103-77898125 CCTTCCTCCCAGGAGCCAGAACA 0: 1
1: 0
2: 3
3: 34
4: 349
Right 1070605843 10:77898134-77898156 CATCAGCGCAGGTGACCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605843 Original CRISPR CATCAGCGCAGGTGACCAAG TGG Intronic
No off target data available for this crispr