ID: 1070605960

View in Genome Browser
Species Human (GRCh38)
Location 10:77898715-77898737
Sequence AGCCAGGCCATGGAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605960_1070605974 18 Left 1070605960 10:77898715-77898737 CCTGCCCCCTCCATGGCCTGGCT No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605960_1070605976 23 Left 1070605960 10:77898715-77898737 CCTGCCCCCTCCATGGCCTGGCT No data
Right 1070605976 10:77898761-77898783 AGAGGGCCAGGCAGGCGGTAAGG No data
1070605960_1070605970 6 Left 1070605960 10:77898715-77898737 CCTGCCCCCTCCATGGCCTGGCT No data
Right 1070605970 10:77898744-77898766 AGGCCTGTGCATGCCTGAGAGGG No data
1070605960_1070605972 11 Left 1070605960 10:77898715-77898737 CCTGCCCCCTCCATGGCCTGGCT No data
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605960_1070605973 15 Left 1070605960 10:77898715-77898737 CCTGCCCCCTCCATGGCCTGGCT No data
Right 1070605973 10:77898753-77898775 CATGCCTGAGAGGGCCAGGCAGG No data
1070605960_1070605969 5 Left 1070605960 10:77898715-77898737 CCTGCCCCCTCCATGGCCTGGCT No data
Right 1070605969 10:77898743-77898765 CAGGCCTGTGCATGCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605960 Original CRISPR AGCCAGGCCATGGAGGGGGC AGG (reversed) Intronic