ID: 1070605961

View in Genome Browser
Species Human (GRCh38)
Location 10:77898719-77898741
Sequence CAGGAGCCAGGCCATGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 799
Summary {0: 1, 1: 2, 2: 11, 3: 86, 4: 699}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605961_1070605970 2 Left 1070605961 10:77898719-77898741 CCCCCTCCATGGCCTGGCTCCTG 0: 1
1: 2
2: 11
3: 86
4: 699
Right 1070605970 10:77898744-77898766 AGGCCTGTGCATGCCTGAGAGGG No data
1070605961_1070605972 7 Left 1070605961 10:77898719-77898741 CCCCCTCCATGGCCTGGCTCCTG 0: 1
1: 2
2: 11
3: 86
4: 699
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605961_1070605974 14 Left 1070605961 10:77898719-77898741 CCCCCTCCATGGCCTGGCTCCTG 0: 1
1: 2
2: 11
3: 86
4: 699
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605961_1070605969 1 Left 1070605961 10:77898719-77898741 CCCCCTCCATGGCCTGGCTCCTG 0: 1
1: 2
2: 11
3: 86
4: 699
Right 1070605969 10:77898743-77898765 CAGGCCTGTGCATGCCTGAGAGG No data
1070605961_1070605976 19 Left 1070605961 10:77898719-77898741 CCCCCTCCATGGCCTGGCTCCTG 0: 1
1: 2
2: 11
3: 86
4: 699
Right 1070605976 10:77898761-77898783 AGAGGGCCAGGCAGGCGGTAAGG No data
1070605961_1070605973 11 Left 1070605961 10:77898719-77898741 CCCCCTCCATGGCCTGGCTCCTG 0: 1
1: 2
2: 11
3: 86
4: 699
Right 1070605973 10:77898753-77898775 CATGCCTGAGAGGGCCAGGCAGG No data
1070605961_1070605978 28 Left 1070605961 10:77898719-77898741 CCCCCTCCATGGCCTGGCTCCTG 0: 1
1: 2
2: 11
3: 86
4: 699
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605961 Original CRISPR CAGGAGCCAGGCCATGGAGG GGG (reversed) Intronic
900125466 1:1067232-1067254 GAGGAGCCGGGCCATGGCAGGGG + Intergenic
900297126 1:1957449-1957471 CAGGACCCAGGCGGTGCAGGCGG - Intronic
900376095 1:2355537-2355559 CAGGGGCACGGGCATGGAGGTGG + Intronic
900505367 1:3027667-3027689 CTGGAGCCATGCCATGGGGCAGG - Intergenic
900529977 1:3148361-3148383 CAGGAGCCAGGAGCTGCAGGAGG + Intronic
900556493 1:3283401-3283423 CTGCAGCCAGACCCTGGAGGTGG + Intronic
901230158 1:7637292-7637314 CAGAAGCCCGGCCCTGCAGGAGG - Intronic
901757078 1:11448017-11448039 CAGGATTAAGGCCAGGGAGGAGG + Intergenic
902218120 1:14947392-14947414 CAGGAGCCTGGCCTTGGGGAGGG + Intronic
902449635 1:16488698-16488720 CATGAGCAAAGGCATGGAGGTGG - Intergenic
902504847 1:16932644-16932666 CATGAGCAAAGGCATGGAGGTGG + Intronic
902561047 1:17277710-17277732 CAGGAGCCTGGGCATGGGGAGGG + Intronic
902647074 1:17807008-17807030 CATGAGCCAAGCAATGCAGGTGG - Intronic
902923367 1:19680362-19680384 CAGGAGCCAGAACAGGGAGTTGG - Intergenic
903267074 1:22163912-22163934 CAGAAGCCAGGCCATGTGGGAGG + Intergenic
903330291 1:22593649-22593671 CTTCAGCCAGGCCATGGAGGTGG + Exonic
903620606 1:24695543-24695565 CAGGAGCCAGGGCAGGAAGTAGG + Intergenic
903691783 1:25179299-25179321 CAACAGCCAGGCCATGCTGGAGG - Intergenic
903694500 1:25197103-25197125 GACGAGCCAGGGCATGGAGCAGG + Intergenic
903733440 1:25514915-25514937 CAGGACGGAAGCCATGGAGGAGG - Intergenic
903736223 1:25531353-25531375 CAGGAGACAGTCCAGGGAGTGGG - Intergenic
904130802 1:28273872-28273894 CTGGAGCCAGGCCTTGGGGAGGG - Intronic
904131746 1:28280786-28280808 CAGGAGTCAGGTCATGTAGCGGG - Exonic
904246971 1:29194673-29194695 CAGGAGGCAGGCCCAGGAAGGGG - Intronic
904372500 1:30058762-30058784 CAGGATCCAGGACAGGAAGGGGG + Intergenic
904458696 1:30662759-30662781 CGGGTGCCAGGCAAGGGAGGTGG + Intergenic
904749016 1:32729321-32729343 TTGGTGCCAGGCCCTGGAGGAGG - Intergenic
904778073 1:32924135-32924157 CATGAGCGGAGCCATGGAGGAGG + Intergenic
905251101 1:36648986-36649008 CAGGATCCAGGACATGCATGGGG - Intergenic
905483167 1:38275445-38275467 CAGGAGTCTGGCCTTGCAGGGGG + Intergenic
906087991 1:43152377-43152399 CAGGAGCCAGCCCTGGGAAGAGG - Intronic
906251123 1:44311769-44311791 CAGGAGCCAGGTCCTGGCTGGGG + Intronic
906691939 1:47798520-47798542 CAGGATGCAGGCCAAGGATGAGG + Intronic
906726779 1:48050072-48050094 CAAGGGCAAGGCCATGGAGTAGG - Intergenic
906806600 1:48785119-48785141 CTGGAGCTAGTCTATGGAGGGGG - Intronic
906813324 1:48851423-48851445 CAGGGGCCAGAGCATGGAAGGGG + Intronic
907670727 1:56472847-56472869 CAGGAGGCAGGACAAGGTGGAGG + Intergenic
907912076 1:58835626-58835648 CAGGTGCCTGGCCCAGGAGGTGG - Intergenic
907926985 1:58964539-58964561 CAGCAGCCAGGATCTGGAGGAGG - Intergenic
910263792 1:85316831-85316853 CAGAAGCAAAGGCATGGAGGTGG - Intergenic
911197071 1:95005356-95005378 CAGGAGCAAGGTAATGAAGGAGG + Intronic
911343931 1:96673975-96673997 CAGTAGCCAGGGCCTGGAGTTGG + Intergenic
912228707 1:107766848-107766870 AAGGAGACAGGCCATGCAGATGG + Intronic
912261796 1:108118242-108118264 CAGAAGACAGGCTGTGGAGGAGG + Intergenic
912449262 1:109759339-109759361 CAGCATCCAGGCCATGAATGTGG - Exonic
913169813 1:116221943-116221965 CAGAAGCAATGCCAGGGAGGAGG + Intergenic
913380201 1:118202254-118202276 CAGGAGCAAGAGCATGAAGGGGG + Intergenic
913957565 1:143319059-143319081 CCAGAGCCAGGCCATAGAGATGG + Intergenic
914051876 1:144144423-144144445 CCAGAGCCAGGCCATAGAGATGG + Intergenic
914127321 1:144822118-144822140 CCAGAGCCAGGCCATAGAGATGG - Intergenic
914254290 1:145948554-145948576 GAGAAGCCAGGGCATGGGGGTGG + Intronic
914917523 1:151827726-151827748 CAGGAGCTGGGCCGTGGAGTGGG + Intronic
916853631 1:168727944-168727966 GAGGAGGCAGTCCAGGGAGGAGG - Intronic
917103433 1:171468769-171468791 AATTAGCCAGGCCATGGTGGCGG + Intergenic
918148150 1:181776013-181776035 CAGGCTTCAGGGCATGGAGGAGG - Intronic
918358068 1:183724681-183724703 CAGGAGCCAGGGCCTAGAGTTGG - Intronic
918532331 1:185537474-185537496 CAGGAGCCAGGGAATGAAGTTGG + Intergenic
919409347 1:197225169-197225191 CTGGAGCCAGGCCATCTCGGTGG - Intergenic
920033396 1:203050404-203050426 CAGTACCCAGGCCAGAGAGGTGG + Intronic
920201286 1:204261364-204261386 CTGGATCCAGGCCATGGGGGAGG - Exonic
920513691 1:206568628-206568650 CTGGAGCCAGCATATGGAGGTGG + Intronic
920539816 1:206769849-206769871 CAAGAGCAAGGCCGTGGAGCAGG - Exonic
920703525 1:208235439-208235461 CTGGAGCCAGGCCCGGGAAGAGG - Intronic
920928326 1:210363660-210363682 CAGGGCCCAGGTCATGGTGGGGG + Intronic
922044373 1:221929040-221929062 CAGGAGCCTGGTCTTGGAGTGGG - Intergenic
922050347 1:221983423-221983445 CATGAGCAAAGGCATGGAGGTGG - Intergenic
922790034 1:228306265-228306287 GTGGAGCCAGGCCAGGGAGCTGG + Intronic
922980450 1:229821770-229821792 CATGTGCCAGGCCCTGGGGGTGG - Intergenic
923261509 1:232272342-232272364 CCAGAGCCAGGCCAAGCAGGTGG - Intergenic
923325050 1:232873545-232873567 CAAGAGCCATGCCATGGAGTGGG - Intergenic
923400772 1:233614067-233614089 CGGGAGCCAGGCCCGGGCGGGGG + Exonic
923967046 1:239153822-239153844 CAGGAGGTAGGACATGGAGTTGG + Intergenic
924445336 1:244124655-244124677 ATGGAGCCAGGTCATGGAGCAGG + Intergenic
924617277 1:245622719-245622741 CAGGAGGCAGGCCAGGTATGAGG + Intronic
924770383 1:247074813-247074835 TAGGATCCAGGCCATGCAGCAGG - Intronic
924793318 1:247272868-247272890 CAGGAGCCAGGGCTTGGAAAAGG + Intergenic
924904149 1:248433806-248433828 CGGGAGCCAGGCCATTGCCGAGG - Intergenic
924923746 1:248658245-248658267 CGGGAGCCAGGCCATTGCTGAGG + Intergenic
1063271542 10:4514890-4514912 AAGGAGCCAGGCTCTGGAGCAGG - Intergenic
1063839067 10:10049228-10049250 CAGCAGGGAGGCCATGGATGTGG + Intergenic
1063877741 10:10497671-10497693 CAAGGGCAAGGCCATGGAGCAGG + Intergenic
1064442312 10:15364761-15364783 CAGGAGCCAAGGAATGCAGGTGG - Intronic
1066476191 10:35749545-35749567 CAGGTTCCAGGCCATGGTGCTGG - Intergenic
1066661394 10:37740794-37740816 CTGGAGCCAGTCCATGGTTGGGG + Intergenic
1066760101 10:38741524-38741546 CCAGAGCCAGGCCATAGAGATGG - Intergenic
1066961512 10:42231244-42231266 CCAGAGCCAGGCCATAGAGATGG + Intergenic
1066996612 10:42570123-42570145 CTGGAGCCTGGCCATGCAGTAGG + Intergenic
1067319531 10:45205149-45205171 CAGGAGCTGGGCCCTGGAGCTGG + Intergenic
1068798070 10:61106261-61106283 CATGAGCCAAGCCATAGAGGAGG + Intergenic
1069428594 10:68312757-68312779 AATTAGCCAGGCCATGGTGGCGG - Intronic
1069623263 10:69850852-69850874 AGGGGGCCAGGCCATGAAGGGGG + Intronic
1070330197 10:75410776-75410798 CAGGAGCAAAGCCCTTGAGGTGG - Intergenic
1070605961 10:77898719-77898741 CAGGAGCCAGGCCATGGAGGGGG - Intronic
1070762018 10:79029833-79029855 CAGGAGACAGGAAATGGAAGAGG + Intergenic
1070775753 10:79108846-79108868 CAGGAGCCAGGCAGGGGAGAAGG - Intronic
1071046683 10:81387510-81387532 CAGGAGCCAAGTCATGGAACTGG + Intergenic
1071051178 10:81450675-81450697 CAGGAGCCAGGGCTTGGACAGGG + Intergenic
1073004896 10:100315811-100315833 GAGGAGGCAGGGGATGGAGGAGG - Intronic
1073054278 10:100689136-100689158 CAGGAGCCTGTCCATGGCGGGGG + Intergenic
1073321205 10:102617280-102617302 CAGGAGCCTGCCCCTGGAGATGG - Exonic
1073429391 10:103476492-103476514 CAGGATCCAGACCAGGGGGGCGG + Exonic
1073513257 10:104055881-104055903 CGGGTGCCATGCCCTGGAGGCGG + Exonic
1073520212 10:104121672-104121694 CTGGAGCCAGAGAATGGAGGCGG + Intergenic
1074148588 10:110738775-110738797 AAGGTGCCAGAGCATGGAGGCGG + Intronic
1074379847 10:112970408-112970430 AAGCACCCAGGCCCTGGAGGAGG - Intronic
1074880686 10:117655425-117655447 GAGGAGCCAGGCCACAGATGTGG + Intergenic
1075016104 10:118910915-118910937 AAGGAGCCAGGCCAGGCAGTGGG + Intergenic
1075616500 10:123893674-123893696 CTGGGGATAGGCCATGGAGGAGG - Intronic
1075719484 10:124576514-124576536 CTGGGGGCAGGCCATGGAGGGGG - Intronic
1075719515 10:124576598-124576620 CTGGGGGCAGACCATGGAGGAGG - Intronic
1075916885 10:126175314-126175336 CAGCAGGCAGGCCATTGTGGAGG - Intronic
1076272575 10:129166834-129166856 CAGGACCCAGGACACGGAGCAGG + Intergenic
1076372966 10:129966899-129966921 CCGCAGCCAGGCCAGGGATGGGG + Intergenic
1076615307 10:131750819-131750841 CAGGAGGCTGGCCACAGAGGAGG + Intergenic
1076704360 10:132293244-132293266 CAGGCGCCAGGCCTGGGTGGAGG - Intronic
1076834964 10:133016403-133016425 CAGGGTCCAGGCCAGGGAGCGGG + Intergenic
1076864562 10:133160464-133160486 CAGGATGCAGGCCATGGACCCGG + Exonic
1076864893 10:133161642-133161664 CCGAATCCAGGCCATGGTGGGGG - Intronic
1077395891 11:2321045-2321067 CCTGAGCCAAGCCATGGTGGAGG - Intergenic
1078725819 11:13929967-13929989 AGGGAACCAGGCCATGGAGAAGG + Intergenic
1078850575 11:15159194-15159216 GTGGAGCCAGGGCATGGTGGAGG + Intronic
1079985944 11:27201048-27201070 CAGGAGTCAGGGTGTGGAGGTGG - Intergenic
1080350431 11:31379180-31379202 TAGGAACCAGGCCATGCAGCAGG + Intronic
1080635605 11:34120883-34120905 TTGGAGCCAAGCCATGAAGGAGG + Intronic
1081853539 11:46290223-46290245 CAGGAGCCAGGACATGGTTCAGG - Intronic
1081867147 11:46366290-46366312 AAGGTGCCAGGCCCTGGAGAGGG + Exonic
1083161721 11:60858542-60858564 CACGTGCCAAGGCATGGAGGTGG - Intergenic
1083319849 11:61838888-61838910 AAGGAGCAAGGCCATGGACAAGG - Intronic
1083470514 11:62881023-62881045 CATGAGCCAGGACACCGAGGTGG + Exonic
1083512711 11:63226774-63226796 CAGGAGCCTGGGCTTGGAGTTGG + Intronic
1083889396 11:65588467-65588489 CAGCAGGCAGGCCATGGTGGTGG + Intronic
1084040400 11:66539394-66539416 CAGGGGCAAGGCCAAGGAAGGGG + Exonic
1084455816 11:69267697-69267719 CAGGAGGCAGGCCCCAGAGGAGG + Intergenic
1084531552 11:69730703-69730725 CAGGAGCCAGGACAGAGAGGGGG + Intergenic
1084589235 11:70080459-70080481 CAGGAGCCAGGGGATGGTAGTGG + Intronic
1084590791 11:70088961-70088983 CAGCAGCCAGGCACTCGAGGGGG - Intronic
1084675259 11:70630303-70630325 CAGGAACCAGGCCACGGCTGAGG + Intronic
1085147386 11:74213348-74213370 CAGGAGCCAGGGCTTGGAATTGG - Intronic
1085477084 11:76795609-76795631 CAGGGGCCACGGCATGGTGGGGG - Exonic
1087118236 11:94545527-94545549 CAGGTACGAGGCCAGGGAGGAGG - Exonic
1087144501 11:94798740-94798762 CAGGAGCCAGGACCAAGAGGAGG + Intronic
1088796526 11:113270357-113270379 CAAGGGCAAGGACATGGAGGAGG + Exonic
1089500468 11:118928953-118928975 CAGGTGCCAGGCCCTGGGGCAGG - Intronic
1089507206 11:118971892-118971914 CCGGGACCTGGCCATGGAGGCGG - Exonic
1089664759 11:120011250-120011272 CAGGAGCCAGGCTGTCGTGGAGG + Intergenic
1089692495 11:120195606-120195628 CAGGAGCAGGGGCAGGGAGGGGG - Intergenic
1089792254 11:120953595-120953617 CACGGGCCAGACCAGGGAGGGGG + Intronic
1090360875 11:126171850-126171872 CAGGAGACAGGCCACAGGGGAGG - Intergenic
1090404083 11:126466903-126466925 CTGGAGGGAGGCCTTGGAGGCGG - Intronic
1090644396 11:128755983-128756005 CAAGAGACAGCCCATGGAGCAGG + Intronic
1091149422 11:133313663-133313685 CAGGAGCCAGGGAATGCAGGTGG + Intronic
1091382326 12:69964-69986 CAGGAGCAATACCAGGGAGGGGG - Intronic
1091400186 12:176549-176571 CAGTAGCCGGGCCAGGTAGGAGG + Exonic
1091650334 12:2304570-2304592 CTGGGGCCAGGTCATGGAGCTGG - Intronic
1092002797 12:5045282-5045304 CAGCAGCCAGGGGGTGGAGGAGG + Exonic
1092165268 12:6338501-6338523 TTGGAGCCAGGCCCTGGAGATGG - Intronic
1092193015 12:6533907-6533929 CAGGAGCCAGGAGATGGGGAGGG + Exonic
1092791368 12:12073293-12073315 CAGGAGCCAGCCCCAGAAGGAGG - Intronic
1092843635 12:12565108-12565130 AATGAGCCAAGACATGGAGGTGG + Intergenic
1092944101 12:13437086-13437108 CAGGAGAAAAGCCATGGATGTGG - Intergenic
1095490628 12:42729813-42729835 CGGGAGCCAGGCTGTGGAGCTGG + Intergenic
1096700994 12:53382655-53382677 TATTAGCCAGGCCTTGGAGGGGG - Exonic
1096840008 12:54374375-54374397 CAGCAGCCAGGCCCTGGGTGTGG - Intronic
1097425983 12:59445540-59445562 CAGGAGCTAGGGCCTGGAGTTGG + Intergenic
1097699805 12:62808515-62808537 CAGGAGCCAGCCCACAGAGCAGG - Intronic
1098333908 12:69382326-69382348 CAGGAGCCAGGGCCTGGAGTTGG + Intronic
1098355690 12:69610631-69610653 CCGGAGGCAGGCTATTGAGGTGG + Exonic
1100990186 12:100243611-100243633 GTGGAGGCAGGCCCTGGAGGAGG - Intronic
1101607554 12:106259048-106259070 CAGGAGCCAGAGCCTGGAGTTGG - Intronic
1101758697 12:107641762-107641784 CAGGAGAGATGCCATGAAGGTGG + Intronic
1101862013 12:108490375-108490397 CAGGAACGAGGGCATGAAGGGGG + Intergenic
1101875735 12:108596002-108596024 CAGGAGCCAGACCACAGAGCTGG - Intronic
1102043551 12:109815907-109815929 CAGGAGCCAGGGCAAGGGAGGGG + Intronic
1102057634 12:109908464-109908486 CAGAGGCCTGGCCATGCAGGTGG - Intronic
1102071265 12:110021912-110021934 CAGGAGAAAGGCTATGAAGGTGG - Intronic
1102232360 12:111272320-111272342 CAGAAGCGTGGGCATGGAGGAGG - Intronic
1102554645 12:113719034-113719056 CAGGAGCTGGGCCCTGGAGGGGG - Intergenic
1103276036 12:119712554-119712576 GAGGAGCCCCGCCCTGGAGGTGG - Intronic
1103603911 12:122072581-122072603 CTGGAGCAAGGCCAGGGAAGAGG - Intergenic
1103800261 12:123533473-123533495 CAGGAGGGTGGCCATGGAGGAGG - Exonic
1103990362 12:124795082-124795104 CAGGAACCAGGGCATGGGGAGGG - Intronic
1104391867 12:128397637-128397659 TGGGACCCAGGCCTTGGAGGAGG - Intronic
1104469848 12:129020755-129020777 CAGGAGGCAGGCATTGGTGGGGG + Intergenic
1104892837 12:132148661-132148683 TAGGGGCCAGGCCGGGGAGGGGG + Intronic
1105015509 12:132784283-132784305 AAGGATCCAGGCCCTGGAGGCGG - Exonic
1105293643 13:19070663-19070685 CAGGAGCCAGGGAGTGTAGGTGG - Intergenic
1105304411 13:19158802-19158824 CAGGGGCCAGGCCAGGCTGGAGG + Intergenic
1105326844 13:19378040-19378062 CAGGACTCACGCCAAGGAGGAGG - Intergenic
1105864846 13:24450624-24450646 CAGGACTCACGCCAAGGAGGAGG + Intronic
1106315846 13:28592528-28592550 CAGAAACCAGGACATCGAGGTGG - Intergenic
1106670270 13:31897832-31897854 CAGGAGCCAGGCAATGCAGTTGG - Intergenic
1107808168 13:44174359-44174381 CAGGAGCCAGAGCCTGGAGTCGG + Intergenic
1109024605 13:57142389-57142411 CAGCAGCCTGGCTCTGGAGGAGG - Exonic
1109025592 13:57148959-57148981 CAGCAGCCTGGCTCTGGAGGAGG - Exonic
1109026582 13:57155532-57155554 CAGCAGCCTGGCTCTGGAGGAGG - Exonic
1109027574 13:57162103-57162125 CAGCAGCCTGGCTCTGGAGGAGG - Exonic
1109028560 13:57168668-57168690 CAGCAGCCTGGCTCTGGAGGAGG - Exonic
1110356762 13:74575899-74575921 CCGGCCCCAGGCCGTGGAGGAGG + Intergenic
1110436438 13:75482020-75482042 GAGGCGCCAGCCCAAGGAGGAGG - Exonic
1110597789 13:77338125-77338147 CAGGAGCCAAGAAATGCAGGTGG + Intergenic
1112987396 13:105468030-105468052 CACGAGCCAAGGCATGCAGGAGG - Intronic
1113900770 13:113796678-113796700 CAGGAGCCCAGCCAGGGAGGAGG - Intronic
1114007852 14:18333241-18333263 CAGGAGCTGGGCCCTGGAGCCGG - Intergenic
1114314476 14:21496751-21496773 CAGAGGCCAGGCTATGGAGCAGG + Exonic
1114528937 14:23383224-23383246 CAAGCGCCAGGCCGAGGAGGCGG - Exonic
1114534458 14:23414006-23414028 CAAGCGCCAGGCCGAGGAGGCGG - Exonic
1114689192 14:24564348-24564370 CAGGAGCAAGGTATTGGAGGGGG - Intergenic
1116413270 14:44650136-44650158 CAGGAGCCAGGGCCTGGAGTTGG - Intergenic
1117791046 14:59342759-59342781 ATGGAGCCCGGCCATGTAGGAGG + Intronic
1119703987 14:76772861-76772883 CAAGAGCCAGGCGTGGGAGGTGG + Intronic
1120721245 14:87891712-87891734 CAGGAGCCAAGAAATGCAGGTGG + Intronic
1120945717 14:89994846-89994868 GAGGACAAAGGCCATGGAGGTGG + Intronic
1121347393 14:93146182-93146204 AAGGGGCCAGGGCATGGAGATGG + Intergenic
1121586974 14:95069190-95069212 CAGAACCCAGGCCATGGTGGTGG + Intergenic
1122206866 14:100152027-100152049 CTGAAGCCAGGGCTTGGAGGTGG + Intronic
1122294284 14:100696410-100696432 CACGAGCCAGGCCAGGGAGAGGG + Intergenic
1122312250 14:100804563-100804585 GAGAAGCCAGCCCAGGGAGGAGG + Intergenic
1122359738 14:101152194-101152216 CAGCAGTGAGACCATGGAGGGGG - Intergenic
1122383423 14:101327039-101327061 CAGGAGCCAGGCCTGAGAGCAGG - Intergenic
1122400138 14:101462119-101462141 CAGGAGCCAGGACCTGCTGGAGG - Intergenic
1122408562 14:101514419-101514441 CTGGAGCCTGGACATGGAGGGGG - Intergenic
1122891265 14:104733288-104733310 CAGAAGTCAGGGCGTGGAGGTGG + Intronic
1122938042 14:104968883-104968905 CCAGAGTGAGGCCATGGAGGCGG + Intronic
1122966012 14:105126378-105126400 CAGGAGCCAGGGCAGGGTGGAGG + Intergenic
1122976445 14:105172789-105172811 CTGGTGGCAGGCCATGCAGGTGG - Intergenic
1123069880 14:105637472-105637494 CAGGCGCCAGGCCCTGCAGGGGG + Intergenic
1202930816 14_KI270725v1_random:31031-31053 CCAGAGCCAGGCCATAGAGATGG - Intergenic
1123443273 15:20304896-20304918 CGAGAGCCAGGCCATAGAGTAGG - Intergenic
1123443513 15:20306134-20306156 CCAGAGCCAGGCCATAGAGATGG - Intergenic
1123443585 15:20306391-20306413 CAAGAGCAAGGCCAGGGAGAAGG - Intergenic
1124341734 15:28894340-28894362 CAGGAGGGAGGGCATGGAGGGGG + Intronic
1124965443 15:34429627-34429649 CAGGAGGAAGGGCATGGAAGGGG - Intronic
1124982062 15:34575829-34575851 CAGGAGGGAGGGCATGGAAGGGG - Intronic
1126420754 15:48469756-48469778 CAGGGTACAGGCCATGGAGAGGG + Intronic
1128308441 15:66615292-66615314 CCGGAGCCAGGCAGAGGAGGGGG + Intronic
1128364554 15:66988521-66988543 CAGGAGCCAGGGCCTAGAGTCGG - Intergenic
1128672804 15:69586924-69586946 CAAGAGGCAGGCCCTGGCGGTGG + Intergenic
1128674462 15:69598413-69598435 CATGAGCCAAGACATGCAGGTGG - Intergenic
1128733291 15:70035063-70035085 GATGAGGAAGGCCATGGAGGAGG - Intergenic
1128740850 15:70082803-70082825 GAGGAGCCAGGGCAGGGAGGAGG + Intronic
1128982521 15:72197735-72197757 CCGGAGCGAGGCCACCGAGGAGG - Exonic
1129392687 15:75228470-75228492 GATTAGCCAGGCCTTGGAGGTGG + Intergenic
1129642465 15:77394142-77394164 CAGGAGCCAGGGCCTGGAGTTGG - Intronic
1129885886 15:79036628-79036650 CAGGGGCCAGTTGATGGAGGGGG + Intronic
1129893420 15:79086963-79086985 AAGGGCCCAGGCCAGGGAGGTGG + Intronic
1129944014 15:79523771-79523793 CAGAAGCTGGGCCATGGAGTGGG + Intergenic
1129944121 15:79524431-79524453 CAGAAGTCAGGCCATGGCGTGGG + Intergenic
1130022206 15:80241141-80241163 CAAGAGCTAAGCGATGGAGGTGG + Intergenic
1130755879 15:86762616-86762638 AAGGAGCCAATCCATGGAGAAGG + Intronic
1131156905 15:90081108-90081130 CAGGAGCCAGGCAGGGGTGGAGG - Exonic
1131558982 15:93423111-93423133 CTGGGGCTAGGCCATGGAGGAGG + Intergenic
1132744504 16:1431110-1431132 TAGGAGCCAGGGCCTGGGGGAGG + Intergenic
1132827674 16:1913275-1913297 AGGGTGCCAGGCCAGGGAGGGGG + Intronic
1132852877 16:2032814-2032836 GCGGTGCCAGGCCCTGGAGGTGG + Intronic
1132869941 16:2111491-2111513 CATGAGCCTGGCCGTGGAGCAGG - Exonic
1132973435 16:2700140-2700162 GAAGAGGCAGGCCAGGGAGGAGG - Intronic
1133472606 16:6090084-6090106 CACGAGCCAAGGCATGCAGGAGG - Intronic
1133816180 16:9199015-9199037 GTGGAGCAAGGCCAGGGAGGTGG - Intergenic
1133834096 16:9351166-9351188 CAGGAGCCAGGGCTTGGAGTTGG + Intergenic
1133887806 16:9846905-9846927 CAGGATCAGGGCCTTGGAGGTGG + Intronic
1134507847 16:14822842-14822864 CTGGAACCAGGCAATGGTGGGGG - Intronic
1134522447 16:14924842-14924864 CAAGAGCCAGGCCGCGGTGGGGG - Intronic
1134710117 16:16323493-16323515 CAAGAGCCAGGCCGCGGTGGGGG - Intergenic
1134717331 16:16363493-16363515 CAAGAGCCAGGCCGCGGCGGGGG - Intergenic
1134717481 16:16364110-16364132 CATGAGCCTGGCCGTGGAGCAGG + Intergenic
1134949486 16:18345152-18345174 CAAGAGCCAGGCCGCGGTGGGGG + Intergenic
1134957271 16:18388049-18388071 CATGAGCCTGGCCGTGGAGCAGG - Intergenic
1134957421 16:18388666-18388688 CAAGAGCCAGGCCGCGGCGGGGG + Intergenic
1134976282 16:18573082-18573104 CTGGAACCAGGCAATGGTGGGGG + Intergenic
1136222323 16:28836354-28836376 CAGGAGCAAGCCCCTGGCGGCGG - Exonic
1136722702 16:32337752-32337774 CCAGAGCCAGGCCATAGAGATGG + Intergenic
1136841024 16:33543751-33543773 CCAGAGCCAGGCCATAGAGATGG + Intergenic
1137044711 16:35644262-35644284 CAGAAGACAGAGCATGGAGGAGG + Intergenic
1137055784 16:35746196-35746218 GAGGTCCCAGGCCATGGTGGGGG - Intergenic
1137623921 16:49895598-49895620 GAGGAGGCAGGTCAGGGAGGTGG - Intergenic
1138096482 16:54215710-54215732 CATGAGCCAGGCCAGGGAGTGGG - Intergenic
1138454937 16:57115771-57115793 CAGGGGCCAGTGCAGGGAGGGGG - Intronic
1138551637 16:57751917-57751939 CTGGAGGCAGGGCAGGGAGGAGG - Intronic
1138554449 16:57763585-57763607 CAGGTGGCAGGCCAGGGAGAGGG - Intronic
1138555648 16:57769859-57769881 CAAGAACCGGGCCATTGAGGAGG - Exonic
1139373968 16:66485404-66485426 CAAGAGCCTGGACATGCAGGTGG - Intronic
1140190464 16:72811603-72811625 CAGGTGCCACGCTGTGGAGGTGG + Exonic
1140468760 16:75203218-75203240 CTTCGGCCAGGCCATGGAGGGGG - Intergenic
1141901389 16:86993492-86993514 CAGGAGACAGGCCTGTGAGGCGG + Intergenic
1142226035 16:88878052-88878074 CAGGGGCCAGGGCCTGGAGCGGG - Intronic
1203003729 16_KI270728v1_random:180012-180034 CCAGAGCCAGGCCATAGAGATGG - Intergenic
1203135337 16_KI270728v1_random:1716419-1716441 CCAGAGCCAGGCCATAGAGATGG - Intergenic
1203151189 16_KI270728v1_random:1844048-1844070 CCAGAGCCAGGCCATAGAGATGG + Intergenic
1142713607 17:1736412-1736434 CAGGAGGCAGGCCATGGGGGCGG + Intronic
1142804483 17:2364207-2364229 CAGGAGCCAGGGCAGGGAGTGGG + Intronic
1143186304 17:5012513-5012535 CTGGAGCCGGGACATGGAGGAGG + Intronic
1143317779 17:6045758-6045780 CAGAAGGCAGGCCTTGGAGGAGG + Intronic
1143457349 17:7076841-7076863 CTGGGGCCAGGCCAGGGAGGAGG - Intronic
1143483295 17:7239111-7239133 CGGGAGGCTGGCCCTGGAGGTGG - Intronic
1143640126 17:8191159-8191181 CAGGGGCCACGTCATGCAGGGGG + Intergenic
1143796750 17:9343081-9343103 CTGGAGCCAGGAGATGGAGAAGG + Intronic
1144632746 17:16882343-16882365 CAGGAGGAAGGCCAGGTAGGAGG + Intergenic
1144685381 17:17222735-17222757 CAGGAGTCAGGTCCTGGAGTTGG - Intronic
1144890190 17:18489971-18489993 CAGGATCCACGACAAGGAGGTGG + Intronic
1145077384 17:19867408-19867430 CGGGGGCGCGGCCATGGAGGTGG - Exonic
1145142026 17:20454347-20454369 CAGGATCCACGACAAGGAGGTGG - Intronic
1145208453 17:20996714-20996736 CAGGAGGAAGGCCAGGTAGGAGG - Intergenic
1145275205 17:21424997-21425019 TAGGAAGCAGGCCAGGGAGGAGG + Intergenic
1145313060 17:21710894-21710916 TAGGAAGCAGGCCAGGGAGGAGG + Intergenic
1145711481 17:26982700-26982722 TAGGAAGCAGGCCAGGGAGGAGG + Intergenic
1146693905 17:34894662-34894684 CAGGAGTCAGGCTATGCATGGGG + Intergenic
1147720374 17:42536260-42536282 CAGGACTGAGACCATGGAGGCGG + Exonic
1147911400 17:43858322-43858344 CAGGAGGCCGGGCTTGGAGGTGG - Intronic
1148002882 17:44400252-44400274 CAGGATCTAGGCCTTGGAGATGG + Exonic
1148124607 17:45230322-45230344 CACCAGGCAGGCCAGGGAGGCGG + Intronic
1148587349 17:48790486-48790508 CAGGAGCCTGGCCAGGGTGGAGG + Intronic
1148804647 17:50258003-50258025 GAGGGGCCGGGCCAGGGAGGAGG + Intergenic
1148870554 17:50656761-50656783 CAGGGGCCCGGCCATGGACCAGG - Exonic
1149376450 17:56048737-56048759 CATGAGCCAGGGTATGCAGGAGG + Intergenic
1150611884 17:66739814-66739836 AAGGAGCCTGGCTGTGGAGGAGG + Intronic
1150888288 17:69113237-69113259 CAGTACCCAGTCCATGGATGAGG - Exonic
1151225450 17:72644656-72644678 CGGGAGACAGGCCAGGGTGGAGG + Intergenic
1151582885 17:74990124-74990146 AAGGAGCCAGGGCATAGAGGTGG + Intronic
1151850235 17:76685618-76685640 CAGTGGCCAGGCCAGGGATGCGG + Intronic
1151961801 17:77409521-77409543 CAGGAGGCAGGCGCTGGGGGCGG + Intronic
1151963020 17:77417289-77417311 CAGCAGCCAAGCTCTGGAGGTGG + Intronic
1152128005 17:78459060-78459082 CAAGAGGCAGGCACTGGAGGAGG - Exonic
1152406961 17:80103339-80103361 TAGGAGCAAGGCCATGGGGGAGG - Intergenic
1152570098 17:81117910-81117932 CAGGAACCAGGCAAGGGTGGGGG + Exonic
1152596865 17:81242037-81242059 CAGGAGCCAGGCCAGAGTGCTGG + Intergenic
1152639367 17:81443266-81443288 CAGCAGCCAGGCCCTGGTGGTGG + Exonic
1152647022 17:81473959-81473981 CAGGAGGCAGGAGTTGGAGGAGG + Intergenic
1152710520 17:81868728-81868750 GTTGAGCCAGGCCAGGGAGGCGG + Exonic
1152717256 17:81906065-81906087 CAGGAGCCAGCCCAAGGATGGGG - Intronic
1152723012 17:81932029-81932051 CAGGAGTCAGGGTATGCAGGGGG - Intergenic
1152753739 17:82078299-82078321 CAGCTGCCAGGTCAGGGAGGAGG + Intergenic
1153003425 18:476626-476648 GAGGGCCCAGGCCATGCAGGTGG + Intronic
1153479267 18:5530688-5530710 CAGGAGCCATGCGGTGGAGAAGG - Intronic
1153944819 18:10009344-10009366 CATAAGCAAGGCCAAGGAGGGGG + Intergenic
1154414958 18:14171601-14171623 CCAGAGCCAGGCCATAGAGAGGG + Intergenic
1154491194 18:14923519-14923541 CAGGAGACAGGGCCTGGAGTCGG - Intergenic
1155063223 18:22247026-22247048 AAGGAGCCAGGTAAGGGAGGAGG + Intergenic
1155065524 18:22265947-22265969 CAGAAGCACGGCCATGGTGGAGG + Intergenic
1155074134 18:22340505-22340527 CATGAGACAGGCCAGGGAAGGGG + Intergenic
1155355920 18:24954093-24954115 CAGGAGCAATGCCTTGGAGCGGG + Intergenic
1155443481 18:25885556-25885578 CAGGAGCCAGGGCCTGGAGTTGG - Intergenic
1156259157 18:35428598-35428620 CAGGAGCAAGGTCATGCTGGAGG - Intergenic
1156356538 18:36346832-36346854 CAGGCCACCGGCCATGGAGGGGG - Intronic
1156484047 18:37453620-37453642 CAGGAGCAATGGCAAGGAGGTGG + Intronic
1157332115 18:46711765-46711787 CAGGAGACATGCCATGGCAGTGG + Intronic
1157404198 18:47409826-47409848 CAGGGGCCAGGCCAGGCTGGAGG + Intergenic
1157879271 18:51304662-51304684 CAGGAGCTAGGACCTGGAAGCGG - Intergenic
1158247235 18:55445911-55445933 CAAGAGACAGGCAAGGGAGGAGG - Intronic
1158481208 18:57823514-57823536 CAGGAGCTAGGGCCTGGAGTTGG + Intergenic
1159080589 18:63731287-63731309 CAGGAGCCAGGTCCTGGAACGGG - Intergenic
1159959824 18:74546712-74546734 CCGAAGCCAGGGGATGGAGGAGG - Intronic
1160309953 18:77779757-77779779 CATGAGCCAGGGAATGAAGGTGG + Intergenic
1160504949 18:79421794-79421816 CAGGACACAGCCCATGGTGGCGG - Intronic
1160530103 18:79557559-79557581 CAGGAGCCTGGAGAGGGAGGTGG + Intergenic
1160535055 18:79587175-79587197 CAGGGGTCAGGCCCTGGTGGAGG + Intergenic
1161065063 19:2233440-2233462 CAGGTGCCAGGCCAGTTAGGTGG + Exonic
1161103435 19:2432475-2432497 CAAGAGGCAGGTCTTGGAGGGGG - Exonic
1161252864 19:3290406-3290428 CAGGGGGCAGGCGAGGGAGGTGG - Intronic
1161273970 19:3405046-3405068 CCGGAGCCAGGCCATGGAGCCGG + Intronic
1161326804 19:3668037-3668059 CAGGAGCCAGGGCAGGGCTGGGG - Intronic
1161455666 19:4368569-4368591 CCAGAGCCAAGCCTTGGAGGAGG - Intronic
1161735152 19:5987646-5987668 CATGAGCCAGGTCGTGGAAGTGG + Intergenic
1161973589 19:7596742-7596764 CAGCTGCCAGGCGCTGGAGGGGG - Intronic
1162423740 19:10581440-10581462 CTGCAGCCAGGCCGTGGAAGGGG + Intronic
1162567313 19:11451610-11451632 CAGGGGCCAGGCCAGGGGGGAGG - Exonic
1162796343 19:13089505-13089527 CAGGACCAAGGCAATAGAGGAGG - Intronic
1163424471 19:17233777-17233799 CACCAGCCAGGCCAAGGAGATGG + Intronic
1163426239 19:17242566-17242588 CAGGACCCAGGCAGTGGTGGAGG - Intronic
1163667609 19:18610631-18610653 CAGGGTACAGGCCAGGGAGGAGG - Intronic
1163722738 19:18905953-18905975 CAGGAACAAGGCCCTAGAGGAGG + Intronic
1164063593 19:21695432-21695454 CATGAGCAGAGCCATGGAGGAGG + Intergenic
1165015685 19:32878434-32878456 GAGGAGCCAGGCCATGGCACCGG - Intergenic
1165106548 19:33473143-33473165 CAGGAGGCAGGAGATGGATGTGG - Intronic
1165213601 19:34254335-34254357 CGGGGGCCAAGCCATGGTGGGGG + Intergenic
1165312826 19:35039324-35039346 CCGGAGCCCGGGCAGGGAGGAGG + Intronic
1165361075 19:35337427-35337449 CAGGAGGCAGGAGATGGAGCAGG + Intronic
1165759199 19:38310669-38310691 CTGGAGCCAAGTCATTGAGGGGG - Intronic
1165941556 19:39417015-39417037 CTGGAGCCAGGCTGGGGAGGGGG + Intronic
1166360887 19:42252605-42252627 CAGGGTCCAGGCCCTGGAGGAGG - Intronic
1166568430 19:43779156-43779178 CAGTGGCCTGGCCATGGTGGAGG + Intronic
1166857011 19:45787223-45787245 TAGGAACCAGGCCATGCAGCAGG + Intronic
1166951047 19:46428299-46428321 CGGGTGCAAGGCCCTGGAGGTGG - Intergenic
1167242255 19:48351380-48351402 CAGCTCCCAGGCCAGGGAGGAGG - Intronic
1167345729 19:48944528-48944550 CAGGCGCCAGGCCTGGTAGGGGG + Intronic
1167376936 19:49117474-49117496 TAGAAGCCAGGCCAGGGAGGAGG + Intronic
1167645836 19:50704320-50704342 AAGGAGACAGGCCGTGGAGGGGG - Intronic
1167780515 19:51595787-51595809 GAGGAACCAGGCCATGGATAAGG - Intergenic
1202691274 1_KI270712v1_random:96847-96869 CCAGAGCCAGGCCATAGAGATGG + Intergenic
925141060 2:1550172-1550194 CAGGAGCCCAGCCCTGGAGCAGG - Intergenic
925269203 2:2590326-2590348 TGGGAGCAAGGCCATGCAGGAGG - Intergenic
925291522 2:2751434-2751456 CAGGAGCCAGACCATGCGAGAGG - Intergenic
925808885 2:7678870-7678892 CAGGAGTCAGGGAAAGGAGGAGG + Intergenic
925906129 2:8540547-8540569 CAGGAGTCTGGCCATGAAGTGGG + Intergenic
926698345 2:15785906-15785928 CAGGAGCCATTCCGTGGAAGGGG + Intergenic
926738143 2:16090015-16090037 GAAGAGCCAGGCTGTGGAGGTGG + Intergenic
926738162 2:16090111-16090133 GAAGAGCCAGGCTGTGGAGGTGG + Intergenic
926738181 2:16090207-16090229 GAAGAGCCAGGCTGTGGAGGTGG + Intergenic
926738200 2:16090303-16090325 GAAGAGCCAGGCTGTGGAGGTGG + Intergenic
926738220 2:16090399-16090421 GAAGAGCCAGGCTGTGGAGGTGG + Intergenic
927130095 2:20051534-20051556 CAGGGGCCCGGCCAAGAAGGAGG - Exonic
928010933 2:27606964-27606986 CATGAGCCAGGGAATGCAGGTGG - Intronic
930175027 2:48292918-48292940 TAGCAACCAGGTCATGGAGGTGG - Intergenic
931689396 2:64822465-64822487 CAGGAGCAAGGCCAGGGGTGGGG - Intergenic
931779391 2:65566239-65566261 CAGTAGACAGGGCATGAAGGAGG + Intergenic
933708797 2:85310187-85310209 CAGGAGCCAGACCATGGGGCCGG - Exonic
933764040 2:85695196-85695218 CAGGAGCTGGGCCTTGCAGGGGG - Intronic
933780293 2:85796327-85796349 CAGGAGCCAAACCAGGGAGACGG - Intergenic
933780469 2:85797181-85797203 CAGGAGCCAAACCAAGGAGACGG - Intergenic
933840752 2:86284061-86284083 CAGCAGGCAGGCCAAGGGGGAGG + Intronic
933877585 2:86634004-86634026 CAGGAGCTAGGCCATGCAGATGG - Intronic
933955116 2:87357103-87357125 CCAGAGCCAGGCCATAGAGATGG - Intergenic
934239304 2:90253317-90253339 CCAGAGCCAGGCCATAGAGATGG - Intergenic
934273879 2:91563381-91563403 CCAGAGCCAGGCCATAGAGATGG + Intergenic
934274152 2:91564714-91564736 CCAGAGCCAGGCCATAGAGAGGG + Intergenic
934323419 2:91985865-91985887 CCAGAGCCAGGCCATAGAGATGG - Intergenic
934461748 2:94216671-94216693 CCAGAGCCAGGCCATAGAGATGG - Intergenic
934554092 2:95278320-95278342 CAGGACCCAGGACCTGGAGCTGG + Intronic
934563028 2:95323050-95323072 TAGGAGGCAGGCAATGGGGGAGG - Intronic
934709001 2:96503173-96503195 CTGGAGGCAGTCCAGGGAGGAGG + Intronic
934713887 2:96532113-96532135 CAGGAGCACGGCCAGGAAGGGGG - Intergenic
934714249 2:96534153-96534175 GAGGTGCTAGGACATGGAGGTGG + Intergenic
934735912 2:96689668-96689690 CAAGAGCCAGGTGCTGGAGGAGG + Intergenic
934778988 2:96957182-96957204 CAGAAACATGGCCATGGAGGCGG - Intronic
934896084 2:98121477-98121499 CTGGCCCCAGGCCATGGAGGTGG + Intronic
935473879 2:103494240-103494262 CATGAGGCAGGCGATGGAGCTGG + Intergenic
936155287 2:110042978-110043000 CAGGTGCCAGGGCTGGGAGGGGG - Intergenic
936189393 2:110328435-110328457 CAGGTGCCAGGGCTGGGAGGGGG + Intergenic
936940328 2:117878110-117878132 CAGGAGCCAGGGCCTAGAGTCGG + Intergenic
937009903 2:118553070-118553092 CAGAAGCCAGGCCAAGGAGCTGG - Intergenic
937084588 2:119162360-119162382 CAGGAGACAGGCCATGGTGCAGG - Intergenic
937164081 2:119795422-119795444 CAGGAGAAAGGCCGAGGAGGGGG - Intronic
937266463 2:120617762-120617784 CAGGATCCAGGCCTTGGTGCTGG + Intergenic
937868174 2:126769360-126769382 CAGCAGCCAGGCCAGGGAGAAGG - Intergenic
938280136 2:130057936-130057958 CAGCAGCAGGGCCATGGAGCTGG + Intergenic
938331093 2:130448651-130448673 CAGCAGCAGGGCCATGGAGCTGG + Intergenic
938358855 2:130672852-130672874 CAGCAGCAGGGCCATGGAGCTGG - Intergenic
939619940 2:144406649-144406671 CGGGAGCCAGGCCATGCAGCAGG + Intronic
940264661 2:151823869-151823891 CAAGAGCCAGGCCTTGGAGACGG + Intronic
941249950 2:163148822-163148844 CAGGACCCTGGCCTTGCAGGGGG + Intergenic
941262788 2:163318222-163318244 CAGGATCCAGGCCCAGGTGGAGG - Intergenic
941856190 2:170233655-170233677 CTGGGGCCAGGCCAAGGATGTGG + Intronic
942321500 2:174740587-174740609 CAGGAGCCAGGAGATGGAGCAGG + Intergenic
942321632 2:174741389-174741411 CAGGAGCCAGGAGATGGAGCAGG - Intergenic
942383546 2:175418720-175418742 CAGGAGTCAAGCCAAGGTGGTGG + Intergenic
944971933 2:205003086-205003108 CAGGAGCCAAGGAATGCAGGTGG - Intronic
946352334 2:219163428-219163450 CAGCAGCAAGGCCATGAAGATGG + Exonic
946410799 2:219514250-219514272 CAGGAGCCAGGCCAGGGGAGGGG - Intronic
946880409 2:224171544-224171566 CAGGGGCCAGGGCTTAGAGGGGG - Intergenic
947595585 2:231409685-231409707 CAGGACCCAGGCCCAGGTGGAGG + Intergenic
947773095 2:232686508-232686530 AAGGAGACAGGGCAGGGAGGAGG - Intergenic
948142653 2:235685223-235685245 CAGCTGCCAGGTCAGGGAGGCGG - Intronic
948570195 2:238912987-238913009 CAGGAGCCAGCACAGGGAAGTGG - Intergenic
948809193 2:240466265-240466287 CAGTAGCCAGGCCCCGGTGGCGG + Exonic
948811286 2:240479705-240479727 CTGGAGCCAGGCCTCGGGGGAGG - Intronic
1169417899 20:5433198-5433220 CAGAAGCCAGCCCAGGGAGTGGG - Intergenic
1170197269 20:13702254-13702276 AATTAGCCAGGCCATGGTGGTGG + Intergenic
1170732188 20:18985099-18985121 CAGGAGCCAGGCCCTGGAGGTGG + Intergenic
1170864147 20:20138048-20138070 CAGGAGCCAGGGCCTGGAATAGG + Intronic
1171180257 20:23086166-23086188 CAGCAGCAGGCCCATGGAGGTGG + Exonic
1171296138 20:24018855-24018877 CAGGGGCCATCCCCTGGAGGTGG + Intergenic
1171453838 20:25255416-25255438 CACCAGCCAGGCCTTGGAGCGGG - Intronic
1171878239 20:30598060-30598082 CAGGAGCCAGGGAGTGCAGGTGG - Intergenic
1172049977 20:32109910-32109932 CAGGGGCAGGGCCAGGGAGGTGG - Intronic
1172696675 20:36827880-36827902 TATGGGCCAGGCCATGGGGGTGG + Intronic
1172701503 20:36856145-36856167 CAGTAGGCAGGGCCTGGAGGTGG - Intronic
1172787579 20:37479385-37479407 CAGGGTCCTGGCCATGGAGTGGG + Intergenic
1172792394 20:37514791-37514813 CAGTAGCAGGGCCATGGAGAAGG - Intronic
1172948134 20:38704106-38704128 CTGGAGCAAGTTCATGGAGGTGG - Intergenic
1173204262 20:40980244-40980266 CAGGAGCTAGGCCCTGGAATGGG + Intergenic
1173251078 20:41364600-41364622 AAGGAGGCAGGCCATGGGGCAGG - Intronic
1173301629 20:41808822-41808844 CAGGAGGCAGAGCTTGGAGGCGG - Intergenic
1175102389 20:56588699-56588721 CAGGAGCCAAGGAATGCAGGCGG - Intergenic
1175131460 20:56792767-56792789 CAGGAGCCAGGGAAAGCAGGCGG + Intergenic
1175182977 20:57161538-57161560 CAGGAGCCTGTCCAGGCAGGGGG + Intergenic
1175308062 20:57991591-57991613 CAACAGCAAGGCCAGGGAGGTGG + Intergenic
1175872847 20:62216568-62216590 CAGCAGCCAGGCGGTGGGGGTGG + Exonic
1176254322 20:64143071-64143093 CAGGAGTCAGGCCAGGCAGTTGG - Intergenic
1176592836 21:8659654-8659676 CCAGAGCCAGGCCATAGAGATGG - Intergenic
1177968598 21:27760088-27760110 CAGGAGCCAGGTGTTGGAGAAGG - Intergenic
1178643336 21:34364245-34364267 GAGGAGCCAGGCCATGTACCAGG - Intronic
1179355040 21:40651176-40651198 CAGGAGACAGGGCCTGGAGTTGG - Intronic
1179373250 21:40826382-40826404 CCCAAGCCAGGCCATGGAAGGGG + Intronic
1179505577 21:41837862-41837884 CAGCAGCCAGGCCATTCTGGAGG - Intronic
1179600417 21:42474085-42474107 CTGGAGCCAGGCAAGGCAGGAGG - Intronic
1179842452 21:44086166-44086188 CAGGAGCCAGGCCATGAGCCTGG - Intronic
1179887898 21:44322249-44322271 CAGTATCCAGGCCCTGCAGGTGG + Intronic
1179934585 21:44593959-44593981 CTGGAGCCAGTCCATGGTTGGGG - Intronic
1180039840 21:45270126-45270148 CTGGAGCCACCCCGTGGAGGAGG - Intronic
1180189427 21:46155392-46155414 TAAGGCCCAGGCCATGGAGGAGG - Intronic
1180232731 21:46437099-46437121 GAGGAGCCAGGCCAGGGACCTGG - Intronic
1180275689 22:10636796-10636818 CCAGAGCCAGGCCATAGAGATGG - Intergenic
1180432358 22:15264051-15264073 CAGGAGCTGGGCCCTGGAGCCGG - Intergenic
1180514922 22:16131989-16132011 CAGGAGCTGGGCCCTGGAGCTGG - Intergenic
1180550172 22:16531736-16531758 CCAGAGCCAGGCCATAGAGATGG - Intergenic
1181012155 22:20047673-20047695 CAGGACCCAGCCCAGGGAGTGGG - Intronic
1181112541 22:20610456-20610478 CAGGGGCCAGGCCAGGCTGGAGG + Intergenic
1181319163 22:21991436-21991458 CAGGAGGCAGGCACTGGAGATGG + Intergenic
1181343380 22:22200082-22200104 CAGGACCCAGATCATGGAGCAGG - Intergenic
1181354504 22:22290085-22290107 CCAGAGCCAGGCCATAGAGATGG + Intergenic
1181430937 22:22881332-22881354 CGGGACCCAGGCTATGGATGAGG + Intronic
1181541986 22:23578525-23578547 CAGGAGCCCGGCCATGGAGGCGG - Intronic
1181729049 22:24831426-24831448 AAGGAGCAAGACCTTGGAGGAGG + Intronic
1182280920 22:29217274-29217296 CAGGAGCCAGGCCAAGGGCTGGG + Intronic
1182294008 22:29302585-29302607 CTGGTGCCAGGGCATGAAGGAGG + Intergenic
1182426202 22:30274242-30274264 AAGGAGCCAGGAGAGGGAGGAGG + Intergenic
1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG + Intergenic
1182761468 22:32725647-32725669 CATGAGCCAAGGCATGCAGGCGG + Intronic
1183243193 22:36673583-36673605 CAGGAGAGAGGACAAGGAGGAGG + Intronic
1183319086 22:37154204-37154226 CAGGAGACAGGGGATGGAGCCGG + Intronic
1183909701 22:41069217-41069239 AAGGAGCCAGTCCATGGAGGTGG - Intergenic
1184336447 22:43855921-43855943 GAGAAGCCAGCCCATGCAGGTGG + Intronic
1184360488 22:44014690-44014712 CAGGAGCCAGGCCAGGAAGGAGG + Intronic
1184423846 22:44397504-44397526 CAGGTGCCAAGGCCTGGAGGTGG - Intergenic
1184699932 22:46163873-46163895 AAGAAACCAGGCCATGGAGGTGG + Intronic
1184762138 22:46550674-46550696 CGGGAGCTGGGCCATGGAGGGGG + Intergenic
1184788043 22:46681211-46681233 CTGGAGCCGGGCCATGGAGGAGG + Intergenic
1185125259 22:49007015-49007037 GAGAAGCCAGGCCAGGCAGGCGG + Intergenic
1185402903 22:50627734-50627756 CAGCAGCCAGGGCCAGGAGGAGG + Exonic
1185413404 22:50697468-50697490 GAGGAGCCCGGCCGTGGAGGAGG + Intergenic
1185419567 22:50727994-50728016 CCGGAGCCTGGCCAGGGAGGTGG + Intergenic
949098374 3:113694-113716 CATGAGCCAGTGAATGGAGGTGG - Intergenic
949113283 3:288596-288618 CAGGAGGGGGGCCATGAAGGAGG + Intronic
949502572 3:4695554-4695576 CAGGAGACAGCCCTTGGGGGAGG - Intronic
949522340 3:4868590-4868612 CAGGAGGCGGGGCACGGAGGGGG - Intronic
950118229 3:10464864-10464886 CTGGTGCAAGGCCATGGAGCAGG + Intronic
950643180 3:14361359-14361381 CAGGAGCCAGGGCCTTGAGCAGG - Intergenic
950674347 3:14545515-14545537 CAGGGGCCTGGCCACGGATGGGG + Intergenic
950759215 3:15206103-15206125 CAGGAGCCGGGCCGCGGGGGCGG - Intergenic
950765264 3:15268595-15268617 CAGGAGCCAAGCCTGGAAGGGGG + Intronic
952303470 3:32124997-32125019 GGGGAGGCAGGGCATGGAGGAGG - Intronic
952956655 3:38561984-38562006 CAGGAGGCAGGGCATGCAGAGGG + Intronic
953032554 3:39187951-39187973 CAGAGGTCAGGGCATGGAGGCGG + Exonic
953133525 3:40163292-40163314 CAGGAGGAAGGCAATTGAGGGGG - Intronic
953180183 3:40587786-40587808 CAGGATCCAAGCCATAGAGCAGG + Intergenic
953390773 3:42532462-42532484 GCTGAGCCAGGCCATGGTGGAGG - Intronic
953877674 3:46675637-46675659 CAAGGGCCAGGCCCTGGAGGAGG - Exonic
954410376 3:50367992-50368014 CCAGGGCCAGGTCATGGAGGAGG - Intronic
954535988 3:51359605-51359627 CTGGAGCCTGGCCAGTGAGGAGG + Intronic
954786662 3:53098446-53098468 CAGAAGCCTGGCCATGGGGTGGG - Intronic
955146605 3:56326150-56326172 GCTGAGCCAGGCAATGGAGGAGG + Intronic
955441055 3:58955892-58955914 CAGGAGCCAGGGCCTGGAAAGGG - Intronic
955467653 3:59253529-59253551 CAGGAGCCAAGGAATGCAGGTGG + Intergenic
955996873 3:64687479-64687501 CAGGAGCGAGGACCGGGAGGCGG + Intronic
959336045 3:105066505-105066527 TAGGAGCCAGGGCCTGGAGTGGG - Intergenic
960225928 3:115168495-115168517 CAGGAGCAAAGAAATGGAGGCGG + Intergenic
961289496 3:125834577-125834599 CATGAGCGGAGCCATGGAGGGGG - Intergenic
961386516 3:126526089-126526111 CTGGAGACAGGCCATGGGAGAGG - Intronic
961391822 3:126556579-126556601 GAGGACCCAGGCCAAGAAGGCGG + Intronic
961469184 3:127100810-127100832 GAGGCCCCAGGCCACGGAGGAGG + Intergenic
961470029 3:127105737-127105759 CAGGAGCCAGGCAGTGGGGCTGG + Intergenic
961567031 3:127771200-127771222 CAGGAGCCAGGCTTTCAAGGAGG - Intronic
961680629 3:128597746-128597768 CAGTGCCCAGGGCATGGAGGGGG - Intergenic
962530784 3:136277888-136277910 CAGGTGCCTGGCCCTGCAGGTGG - Intronic
963525422 3:146409460-146409482 CATGAGCAGAGCCATGGAGGGGG + Intronic
963626297 3:147678296-147678318 CTGGAGCCAGGCCAGCTAGGAGG + Intergenic
963904415 3:150762462-150762484 CAGGAACCTGGCTATGGAGAAGG - Exonic
964258864 3:154811220-154811242 CAGGAGCCAGGACCTGGAGTTGG + Intergenic
965844583 3:172946706-172946728 CATGAGCCAGGGCCTGGAGAGGG - Intronic
966151173 3:176869028-176869050 TGGGAGCCAGGCCCTGGAGTTGG - Intergenic
966834185 3:184036742-184036764 CACGAGCCCGGGCATGGAGAAGG + Exonic
966880143 3:184345432-184345454 CAGGAGCCAGCCCCTCCAGGTGG - Intronic
967468633 3:189837165-189837187 CAGGAGACAGGGCATGCAGAAGG - Intronic
967626834 3:191696310-191696332 CACTACCCTGGCCATGGAGGGGG + Intergenic
967677498 3:192317287-192317309 CAGGAGCCAAGGCCTGGAGCTGG - Intronic
968086877 3:195877778-195877800 CTGGAGGCAGGCCTGGGAGGGGG + Intronic
968576537 4:1368913-1368935 CAGGCGCCATGCAGTGGAGGAGG - Intronic
968742980 4:2340676-2340698 CAGGACCCACTCCACGGAGGTGG + Intronic
968883882 4:3317136-3317158 CGGGAGCCTGGCCCAGGAGGAGG + Exonic
968901809 4:3435589-3435611 CAGGAGCCAGGAGATGCTGGGGG - Intronic
968977838 4:3831086-3831108 CAGGAGGCAGGGCAGGGAGCGGG + Intergenic
969452414 4:7282130-7282152 CAGGAACCAAGCCATGAAGGTGG - Intronic
969480401 4:7443896-7443918 CGGCAGCCAGGCCAGGGAGGTGG - Intronic
969745849 4:9071068-9071090 CATGAGCGGAGCCATGGAGGGGG - Intergenic
969805209 4:9602496-9602518 CATGAGCGGAGCCATGGAGGGGG - Intergenic
969963171 4:10966993-10967015 CAGGAGACAGGCCAGGGAAGAGG + Intergenic
970377639 4:15475398-15475420 CAGGATCAAGGGCCTGGAGGAGG + Intronic
971652253 4:29293352-29293374 CAGGAGCCAAGGAATGCAGGTGG - Intergenic
971954354 4:33396462-33396484 CAGGAGCCAGGACCTGGAACTGG - Intergenic
972061480 4:34879112-34879134 TAGGAGCCAGGCCATGCAGCAGG + Intergenic
972253882 4:37333105-37333127 CATGAGCCAGGGCCTGGAGTTGG - Intronic
973608105 4:52607754-52607776 CAGAAGCCAGGGGTTGGAGGAGG - Intronic
974292346 4:59948657-59948679 CAGGAGCCAGGGCCTGGAATGGG - Intergenic
975179987 4:71333655-71333677 CAGGAACCAGGGCCTGGAGCCGG + Intronic
975882660 4:78929102-78929124 TAGGAACCAGGCCATGCAGCAGG - Intronic
976762766 4:88568409-88568431 CATGAGCCAGGGCCTGGAGTTGG + Intronic
976845739 4:89487299-89487321 AAGCAGCCAGGCCAGGGAGGTGG + Intergenic
977859586 4:101940716-101940738 GAGGAGAAAGACCATGGAGGTGG + Intronic
978213629 4:106170036-106170058 CAGGAACCAGGCCATACAGCAGG - Intronic
978771213 4:112457934-112457956 CAGAGGCCAGGCTATGGAGCAGG + Intergenic
981518398 4:145634849-145634871 CAGGAGCTAGGGCCTGGAAGGGG + Intronic
981980100 4:150781516-150781538 TAGAAACCAGGCCATGCAGGAGG - Intronic
982030720 4:151298022-151298044 CATGAGCCAGGCAATACAGGTGG + Intronic
983557539 4:169071752-169071774 CAGGAGCTCGGCCATGAAGAAGG - Intergenic
985064216 4:186105235-186105257 CCGGAGCCAGGGCGCGGAGGAGG - Intronic
985371069 4:189285379-189285401 GAGGGGCCTGGCCATGGTGGAGG - Intergenic
985780735 5:1869526-1869548 CAGTGGCCGGGCCCTGGAGGAGG + Intergenic
985885704 5:2676122-2676144 AAGGGGCCATGCCATGGGGGAGG + Intergenic
986078615 5:4365280-4365302 CAGGTGCCAGGCCATGGCACTGG - Intergenic
986548401 5:8924770-8924792 CAGGAGCCAGGACCTGGAGTTGG - Intergenic
986597805 5:9441685-9441707 CAGGTGGCAGGCCAAGGAGCAGG + Intronic
986756272 5:10839566-10839588 CAGGAGCCAGGTCCTGGAATAGG - Intergenic
986885172 5:12225682-12225704 CAGGAGTCAGGGCCTGGAGTTGG + Intergenic
987537466 5:19207133-19207155 TAGGAGCCAGGGCCTGGAGTTGG - Intergenic
989135680 5:38152021-38152043 CAGGAGCCAGCCCATCAAGAAGG + Intergenic
991953107 5:71965936-71965958 CAGGAGCCAGGGGATGGAAGGGG - Intergenic
996192595 5:120564046-120564068 CAGGAGCTAGGGCATGGAATAGG + Intronic
996339721 5:122423089-122423111 CAGGAGCTTGGCCCTGGAGATGG + Exonic
997357619 5:133273855-133273877 CATGAGTCAGGGCATGCAGGAGG + Intronic
997383368 5:133453516-133453538 CTGGACCCAGGCCAAGGAGCTGG + Intronic
997396959 5:133568742-133568764 GAGGTGCCAGGCCTTGGAGCAGG - Intronic
997418908 5:133750662-133750684 TAGGAGCCGGGACAGGGAGGTGG - Intergenic
997645291 5:135477748-135477770 CAGGGGCGAGGCCTTCGAGGTGG - Intergenic
997734180 5:136201304-136201326 CAGGAGTCAGGAAATGCAGGGGG - Intergenic
998015682 5:138730207-138730229 AATTAGCCAGGCCATGGTGGCGG + Intronic
999122555 5:149220422-149220444 CAGGAGCCAGGAGAGGGATGGGG - Intronic
999128823 5:149266999-149267021 CAGGAAGCAGGCCATGCAAGTGG - Intergenic
999409292 5:151336354-151336376 CAGGAGCCAGGGTAGCGAGGAGG - Intronic
999975526 5:156908381-156908403 CAAGGGCAAGGCCAGGGAGGAGG + Intergenic
1001228342 5:169964429-169964451 CAGGAGAGAGGCCTGGGAGGGGG + Intronic
1001404127 5:171463646-171463668 CAGGGGCCAGTCCCTGGAGCTGG + Intergenic
1001774082 5:174315678-174315700 CAGGAGAGAGGGCATTGAGGTGG + Intergenic
1001924304 5:175625279-175625301 CAGGACTGAGGCCATGGAGTCGG - Intergenic
1002399922 5:178986090-178986112 CAAGGGCCAGGGCAGGGAGGGGG - Intronic
1002419701 5:179139232-179139254 GAGGAGACAGGCAGTGGAGGAGG + Intronic
1002568452 5:180127294-180127316 CAGGACCCTGGGCAGGGAGGAGG - Intronic
1004469934 6:15920260-15920282 CAGGAGACAGGACATGGACATGG + Intergenic
1005413541 6:25576561-25576583 CAGGAGCCAGGACTTGCATGGGG + Intronic
1006140721 6:31928016-31928038 CAGGAGCCCAGCCATGGCTGAGG - Exonic
1006156003 6:32013118-32013140 CAGGAGCCAGGCCAGGCGGGAGG - Intergenic
1006162336 6:32045972-32045994 CAGGAGCCAGGCCAGGCGGGAGG - Exonic
1006296010 6:33170455-33170477 GAGCAGCCAGGCCAGGGAGTTGG + Intronic
1006455503 6:34129691-34129713 CAGGAGTCAGGCCTGGGAGAGGG + Intronic
1006730383 6:36231624-36231646 CAGGCGCCATGCCATCCAGGTGG - Exonic
1006868627 6:37230090-37230112 CAGGAGCAAGGCCTGGAAGGAGG - Intronic
1007074434 6:39057717-39057739 CAGGTACCAGGTCAGGGAGGGGG - Intronic
1007074475 6:39057849-39057871 CAGGTACCAGGTCAGGGAGGGGG - Intronic
1007092986 6:39195826-39195848 GAGGAGCTAGGGCATGGATGTGG + Intronic
1007226027 6:40315282-40315304 CAGGAGCCATGCCAGGCAGCTGG + Intergenic
1007386425 6:41523300-41523322 CAGCACCCAGGCCATGGAGGTGG + Intergenic
1007483022 6:42162585-42162607 CAGGAGCCAGGCCAAGGACACGG + Intronic
1007519460 6:42440318-42440340 CAGGAGCCAGTCTTTGGAGCGGG + Intronic
1007594866 6:43045258-43045280 CTGGAGCCAGGACATGGCAGAGG - Exonic
1007821657 6:44564878-44564900 CAGGAGCCAGGTAATGCAGCAGG - Intergenic
1009830553 6:68926367-68926389 GAGGAGACAGTTCATGGAGGTGG + Intronic
1010761334 6:79726686-79726708 AAGGAGCCAGGAGATGCAGGAGG - Intergenic
1011019022 6:82789769-82789791 CAGGAGCCAGGGCCTGGATTTGG - Intergenic
1011271150 6:85580865-85580887 CAGGAGCCAGGACCAGGAGTTGG - Intronic
1011404349 6:87002286-87002308 CAGGAGCGAAGCCATGGACTTGG + Intronic
1013226190 6:108120753-108120775 GAGGAGCAAGGCGAGGGAGGTGG - Intronic
1016373157 6:143394781-143394803 AAAGAGCCAGACCAGGGAGGTGG + Intergenic
1016989364 6:149918666-149918688 CACGAGGCTGGCCTTGGAGGAGG + Intronic
1017584275 6:155903124-155903146 CAAGAAGCAGGCCATGGGGGAGG + Intergenic
1018758857 6:166872887-166872909 CAGGAGCCCGCCCAGGGAGGAGG - Intronic
1019267600 7:127138-127160 CATGAGCCAGGCAGTGGAGTTGG - Intergenic
1019518152 7:1448555-1448577 TGGGAGCCAGGCCAAGGATGGGG + Intronic
1020119678 7:5496012-5496034 CAGGAGCAGGGCCATGGAGAAGG - Intronic
1020413219 7:7916037-7916059 CAGCAGCCAGCTCATGGAGAGGG + Intronic
1021923106 7:25506539-25506561 CAGGAGCCAGGGCCTGGAATTGG - Intergenic
1022359354 7:29643671-29643693 CATGAGCGGAGCCATGGAGGAGG + Intergenic
1022517903 7:30987453-30987475 CAGTTGCCAGGCCATGCTGGCGG + Intronic
1022524567 7:31028818-31028840 CAGGAGCCAGGCCCGGCAGCAGG - Intergenic
1023686328 7:42739253-42739275 CATGAGCCAGGGGATGCAGGTGG - Intergenic
1023727788 7:43162429-43162451 GAGGAGGCAGACCATGGAGATGG - Intronic
1023865371 7:44235825-44235847 CTGGAGCCAGGCGGTGGGGGAGG - Intronic
1024181286 7:46897629-46897651 AGGGAGCCAGGCCCGGGAGGAGG + Intergenic
1024825734 7:53387615-53387637 CAGGAGCCAGGCTCCGCAGGTGG - Intergenic
1025198506 7:56948884-56948906 CTGGGCCCTGGCCATGGAGGGGG - Intergenic
1025206374 7:56995683-56995705 CTGGGGCCAGGCCGGGGAGGGGG + Intergenic
1025665561 7:63581244-63581266 CTGGGGCCAGGCCGGGGAGGGGG - Intergenic
1025673445 7:63628049-63628071 CTGGGCCCTGGCCATGGAGGGGG + Intergenic
1026491408 7:70867213-70867235 AATTAGCCAGGCCATGGTGGTGG - Intergenic
1026852850 7:73735725-73735747 CAGGAAGCAGGCGGTGGAGGCGG + Intergenic
1026869552 7:73842125-73842147 CAGGAGCATGGCCCAGGAGGAGG - Exonic
1026930905 7:74222491-74222513 CAGGAGCCAGGTCATGGAGCTGG - Intronic
1026979793 7:74519552-74519574 CAGGAAGCTGGCCATGGAGGAGG - Exonic
1027672629 7:81120168-81120190 CTGGAGCCTGGGCAGGGAGGGGG + Intergenic
1028868037 7:95736257-95736279 TGGGAGCCAGGGCCTGGAGGGGG + Intergenic
1029595687 7:101536450-101536472 CAGGAGCCAGGACACGGAGCTGG + Intronic
1030608632 7:111665245-111665267 AAGGAGCCACGCCATGGGTGAGG - Intergenic
1030662700 7:112238756-112238778 CAGGAGCCAGGGCCTGGAATGGG - Intronic
1032138720 7:129307232-129307254 CAGGAGCCAGCGCTTGGAGTTGG + Intronic
1032382455 7:131499064-131499086 CAGGACCCTGGCCATGGTCGAGG - Intergenic
1033436722 7:141339460-141339482 CAGAAGTCAGGCCAAGCAGGGGG + Intronic
1033529079 7:142245103-142245125 CAAGGGCCAGGCCAGGGAAGGGG + Intergenic
1033529365 7:142247142-142247164 CAGGCACCATGCCATGGGGGAGG + Intergenic
1033879939 7:145868957-145868979 CAGTCCCCAGGCCATGCAGGTGG + Intergenic
1034046175 7:147930032-147930054 TAGGAACCAGGCCATGCAGCAGG - Intronic
1034503341 7:151466381-151466403 CGGGAGCCTGGTCAAGGAGGAGG - Exonic
1034581713 7:152049753-152049775 CTGGAGCCAGGTCCTGGAGTTGG + Intronic
1035125959 7:156607807-156607829 CGGGAGCCAGGCAGAGGAGGCGG + Intergenic
1035391405 7:158507137-158507159 CAGGACCCAGGGCTTGGATGTGG + Intronic
1036289105 8:7471699-7471721 CAGGAGCCAGGCTTGGGAGAGGG + Intronic
1036332370 8:7839828-7839850 CAGGAGCCAGGCTTGGGAGAGGG - Intronic
1036922582 8:12872103-12872125 CAAGTCCCAGCCCATGGAGGCGG - Intergenic
1037672415 8:21026626-21026648 CATGAGCAGGGCCATGAAGGTGG - Intergenic
1038165887 8:25084768-25084790 CATGAGCCAGGCATTGTAGGAGG + Intergenic
1038364310 8:26915610-26915632 CGGGCACCAGGCCATGGAGCGGG - Intergenic
1039493933 8:37966815-37966837 CAGGAGCCTGGCCACGGCAGGGG - Exonic
1040010323 8:42656368-42656390 CCAGAGCCAGGGCATGGAGAGGG - Intergenic
1040107149 8:43547536-43547558 AAGCAGCGAGGCCATAGAGGAGG - Intergenic
1041348922 8:56929518-56929540 CAGGCCTCAGGCAATGGAGGAGG + Intergenic
1041619909 8:59954801-59954823 CATGAGCCAAGACATGTAGGTGG + Intergenic
1042980321 8:74519193-74519215 CAGGAGCCAGGACCTGGAGTTGG - Intergenic
1043993758 8:86787948-86787970 CAGGAGCCAAGGAATGCAGGTGG - Intergenic
1045013930 8:97982138-97982160 CAGGAGCCAGACCCAGGAGGAGG + Intronic
1045395660 8:101758307-101758329 CAGGAGACAGCCTATGGAGGGGG - Intronic
1045651765 8:104348021-104348043 CATGAGCCAGGAAATGTAGGTGG + Intronic
1045930512 8:107620451-107620473 CAGGAGCAAGGGCAAGGATGCGG - Intergenic
1047336334 8:123940216-123940238 CAGGAGGCAGAGCATGGGGGAGG + Intronic
1047850467 8:128851869-128851891 CATGAGCCAAGCAATGTAGGTGG + Intergenic
1048073529 8:131043509-131043531 AAGGAGGCGGGCCAAGGAGGGGG + Intergenic
1048269575 8:133017848-133017870 CAGGTCCCAGGCCATCCAGGTGG + Exonic
1048789513 8:138086556-138086578 CAGGTGACAGAGCATGGAGGAGG - Intergenic
1049054818 8:140227732-140227754 CTGGTGCCAGGCCACGGACGTGG - Intronic
1049151374 8:141037501-141037523 TTGGAGCCAGGCCAAGGGGGAGG - Intergenic
1049240194 8:141533838-141533860 CAGGAGCCAGCCAATGGAGGTGG + Intergenic
1049253434 8:141601330-141601352 CTGGAGCCAGGGCCTGGATGTGG + Intergenic
1049401341 8:142428819-142428841 CTGGAGCCAGGCCTTGGACAGGG + Intergenic
1049410241 8:142470786-142470808 CTGGAGGCAGGGCAGGGAGGGGG - Intronic
1049442764 8:142616794-142616816 CAGGAGCCAGGCCCTTGGTGAGG + Intergenic
1049604140 8:143521273-143521295 CAAGATCCAGGCCGTGAAGGTGG + Intronic
1049605127 8:143525828-143525850 AATGGGCCAGGCCATGGAGGCGG + Intronic
1049656834 8:143802750-143802772 CAGGATCCAGGCCGTGCTGGTGG + Intronic
1049795918 8:144497187-144497209 CAGGTGCTCGGCCATGGCGGCGG - Exonic
1049847572 8:144810485-144810507 CAGTAGCCGGGACATGGTGGGGG + Intronic
1050023073 9:1305141-1305163 CAGGGATCAGGCCCTGGAGGTGG + Intergenic
1050315915 9:4400766-4400788 CAGGAGCTAGGGCCTGGAGCAGG - Intergenic
1051287387 9:15510764-15510786 CAGGAGCGACGCCACCGAGGGGG + Intronic
1052094031 9:24362765-24362787 CAGGAGGCAGGGCCTGGAGTTGG - Intergenic
1052554370 9:29994953-29994975 AATGAGCCAGGCAATGGAGTGGG + Intergenic
1052864461 9:33456713-33456735 TGGGAGGGAGGCCATGGAGGAGG + Intergenic
1052877749 9:33580154-33580176 CAGCAGCCAGGCCATGGAGCTGG - Intergenic
1053040128 9:34863140-34863162 CAGGAGCCAGACCCTGGAGTTGG - Intergenic
1053498236 9:38564051-38564073 CAGCAGCCAGGCCATGGAGCTGG + Intronic
1053692222 9:40592323-40592345 CCAGAGCCAGGCCATAGAGATGG - Intergenic
1054272578 9:63045162-63045184 CCAGAGCCAGGCCATAGAGATGG + Intergenic
1054303480 9:63393289-63393311 CCAGAGCCAGGCCATAGAGATGG - Intergenic
1054402259 9:64719799-64719821 CCAGAGCCAGGCCATAGAGATGG - Intergenic
1054435862 9:65204114-65204136 CCAGAGCCAGGCCATAGAGATGG - Intergenic
1054494530 9:65817573-65817595 CCAGAGCCAGGCCATAGAGATGG + Intergenic
1055079429 9:72254505-72254527 CAGAAGCCAGGCAATAGAGGAGG - Intronic
1055440498 9:76331788-76331810 CATGAGCCAAGGCATGCAGGTGG + Intronic
1056439306 9:86604364-86604386 CAGGAGCAAGACCATGGGGATGG + Intergenic
1056765905 9:89444219-89444241 CAGGGAGGAGGCCATGGAGGTGG - Intronic
1056827028 9:89883605-89883627 CAGGAGGCAGGGCAGGGAGGTGG - Intergenic
1056933885 9:90900789-90900811 CAGGAGACAGAGCATGGAGCAGG - Intergenic
1057161408 9:92890928-92890950 CAGCAGGGAGGCCATGGAGCTGG + Intergenic
1057276111 9:93676758-93676780 CAGCAGCCAGGCCTCGCAGGAGG + Exonic
1057677701 9:97148535-97148557 CAGCAGCCAGGCCATGGAGCTGG + Intergenic
1058724621 9:107790088-107790110 TAGGGGCCAGGCAGTGGAGGTGG + Intergenic
1058820958 9:108728860-108728882 CAGGAGCCAGGGCCTGGAGTTGG - Intergenic
1059175921 9:112170117-112170139 CAGGACCAAGTCCCTGGAGGTGG + Intronic
1059344037 9:113616270-113616292 CAGGCTCCAGGCTCTGGAGGAGG + Intergenic
1059390167 9:113994180-113994202 CAGCAGCCAGGCTATGGCGCTGG + Intronic
1060017510 9:120099355-120099377 CAGCAGCCAGGCCATGGCAGTGG - Intergenic
1060207948 9:121693581-121693603 GAGGAGCCGGGCCTTGGCGGAGG + Intronic
1060240571 9:121898943-121898965 CAGGAGCCAGGCAAAGAAGAAGG - Intronic
1060481514 9:124018960-124018982 CAGCAGCCAGGCCCAGGCGGGGG + Intronic
1060801135 9:126546468-126546490 CAGAGGCCAGGCCTTGGATGGGG - Intergenic
1060801521 9:126548506-126548528 CAGAAACCAGGCCTTGGATGGGG + Intergenic
1060967526 9:127720259-127720281 CAGGAGACAGGCCATGCTGAGGG - Exonic
1061129894 9:128702903-128702925 CCGGAGCGGCGCCATGGAGGAGG + Exonic
1061431863 9:130536363-130536385 CAGGAGCCAGGCTCTGGCTGGGG - Intergenic
1061573042 9:131489504-131489526 AAGAAGCCAGGCCAAGGGGGAGG - Intronic
1061615950 9:131779033-131779055 CAGGAGCCAAGGAATGCAGGCGG + Intergenic
1061728707 9:132596827-132596849 CAGGAGCCAGGCAAGTGAGTAGG + Intronic
1062170639 9:135132978-135133000 GAGGGGCCAGGGCATGTAGGAGG + Intergenic
1062229613 9:135474428-135474450 CAGGAGCCTGCCCAGGGCGGGGG - Intergenic
1062234734 9:135502379-135502401 CAGGTGGGAGGCCAGGGAGGAGG + Intronic
1062247399 9:135576210-135576232 GGGGACCGAGGCCATGGAGGAGG - Intergenic
1062248522 9:135582798-135582820 TAGGAGCCAGGCCACGAAGCAGG - Intergenic
1062389716 9:136329127-136329149 CAGGAGCCAGCCCCTGGCAGGGG + Intronic
1062696971 9:137880502-137880524 CAGGAGCCAGGCCGGGGCGGGGG + Intronic
1203622882 Un_KI270749v1:138460-138482 CCAGAGCCAGGCCATAGAGATGG - Intergenic
1185576531 X:1178950-1178972 ACGGAGCCAGGGCAAGGAGGAGG + Intergenic
1185837321 X:3357101-3357123 CAGGAGCCAGTCCATGGCCTAGG + Intergenic
1186223700 X:7375531-7375553 CAGGAGGGAGGCCAAGGAGTGGG - Intergenic
1186442425 X:9597723-9597745 CAGGAGCAAGGCCATGCCGACGG - Intronic
1187844879 X:23524897-23524919 CAGGAGCTAGGGCCTGGAGAGGG - Intergenic
1188192021 X:27182911-27182933 CAGGAGCCAGGTCCTGGAGTTGG - Intergenic
1188668335 X:32852240-32852262 CAGGAGCCAGGGCCTGGAATGGG - Intronic
1190780791 X:53592944-53592966 CAGGAGCCAGGAGGTGGAGGGGG - Intronic
1192304483 X:69944469-69944491 CAGGAGCCAGGGCCTGGAATGGG + Intronic
1192545248 X:72007523-72007545 CAAGAGCCAGGCCAGTGATGTGG - Intergenic
1192875290 X:75223134-75223156 CAGGAGCTAGGGCATGGAATGGG + Intergenic
1193463430 X:81817746-81817768 CAGGAGCCAGGGCCTGGAGTTGG + Intergenic
1193676038 X:84453925-84453947 CAGGAGCTAGGCCCTGGAATAGG - Intronic
1195199308 X:102532642-102532664 CAGGAGCCAGGGCCTGGAATGGG - Intergenic
1195396115 X:104412185-104412207 CAGGAGCTAGGGCCTGGATGCGG - Intergenic
1195923091 X:110002349-110002371 GACGAGGCAGGCCAGGGAGGAGG + Intergenic
1196217526 X:113071490-113071512 CGGGAGCCAGGGCCTGGAGATGG + Intergenic
1197959167 X:131985479-131985501 CAGAAGCCAAGACATGGGGGAGG - Intergenic
1198088866 X:133307962-133307984 CAAGAGCCTGGGAATGGAGGGGG + Intronic
1198395412 X:136214410-136214432 AAGGAGCCAGAGCGTGGAGGCGG - Intronic
1198996888 X:142582738-142582760 CATGTGCCAGGCCATGGAACTGG - Intergenic
1199457328 X:148043866-148043888 CAGTAGCCAGGGCCTGGAGTTGG + Intergenic
1200009215 X:153108695-153108717 CAGGATCCATGCTCTGGAGGTGG - Intergenic
1200030385 X:153291227-153291249 CAGGATCCATGCTCTGGAGGTGG + Intergenic
1200088738 X:153624596-153624618 GAAGCACCAGGCCATGGAGGAGG - Intergenic