ID: 1070605962

View in Genome Browser
Species Human (GRCh38)
Location 10:77898720-77898742
Sequence TCAGGAGCCAGGCCATGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 8, 3: 48, 4: 388}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605962_1070605978 27 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA 0: 1
1: 0
2: 8
3: 48
4: 388
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605962_1070605976 18 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA 0: 1
1: 0
2: 8
3: 48
4: 388
Right 1070605976 10:77898761-77898783 AGAGGGCCAGGCAGGCGGTAAGG No data
1070605962_1070605972 6 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA 0: 1
1: 0
2: 8
3: 48
4: 388
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605962_1070605973 10 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA 0: 1
1: 0
2: 8
3: 48
4: 388
Right 1070605973 10:77898753-77898775 CATGCCTGAGAGGGCCAGGCAGG No data
1070605962_1070605969 0 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA 0: 1
1: 0
2: 8
3: 48
4: 388
Right 1070605969 10:77898743-77898765 CAGGCCTGTGCATGCCTGAGAGG No data
1070605962_1070605974 13 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA 0: 1
1: 0
2: 8
3: 48
4: 388
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605962_1070605970 1 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA 0: 1
1: 0
2: 8
3: 48
4: 388
Right 1070605970 10:77898744-77898766 AGGCCTGTGCATGCCTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605962 Original CRISPR TCAGGAGCCAGGCCATGGAG GGG (reversed) Intronic
900224600 1:1527084-1527106 TAGGGAGCCTGGCCATGGGGCGG - Intronic
900423211 1:2564604-2564626 TCAGGAGCCGGTCCATGCACAGG - Intronic
900477166 1:2881461-2881483 TCTGGGGCCAGGGCAGGGAGTGG + Intergenic
900802450 1:4745779-4745801 TCAGGACGCTGGCCTTGGAGAGG - Intronic
900826590 1:4931846-4931868 TCACCAGCCAGGCCTAGGAGAGG + Intergenic
900880140 1:5375501-5375523 TCAGCAGACAGGCCAGGGAGAGG - Intergenic
901374258 1:8826274-8826296 TCAGTGGCCAGGCCAGGGTGGGG - Intergenic
902127610 1:14229688-14229710 TCAGGGCCCAAGCCCTGGAGAGG + Intergenic
902218119 1:14947391-14947413 TCAGGAGCCTGGCCTTGGGGAGG + Intronic
902338214 1:15765915-15765937 TCAGGAACCAGGTCTTGGAGAGG - Intronic
902405000 1:16177711-16177733 TCAGAAGCCAGGCAGTGGGGAGG - Intergenic
902561046 1:17277709-17277731 GCAGGAGCCTGGGCATGGGGAGG + Intronic
903676794 1:25069352-25069374 CCAGCTGCCATGCCATGGAGAGG - Intergenic
903736224 1:25531354-25531376 GCAGGAGACAGTCCAGGGAGTGG - Intergenic
903845633 1:26278413-26278435 TCTGGAGCCAGGCCAGGCAGGGG + Exonic
904130803 1:28273873-28273895 GCTGGAGCCAGGCCTTGGGGAGG - Intronic
904131747 1:28280787-28280809 TCAGGAGTCAGGTCATGTAGCGG - Exonic
904380127 1:30104989-30105011 TCATGGGCCAGGTGATGGAGTGG - Intergenic
904832854 1:33316509-33316531 TCTGGAGCCTGGCCATGGTGGGG + Intronic
905353190 1:37361630-37361652 TCAGCAGCCAGGAAGTGGAGGGG + Intergenic
906251122 1:44311768-44311790 TCAGGAGCCAGGTCCTGGCTGGG + Intronic
906952444 1:50345723-50345745 TCAGGGGCCAGGCCTGGCAGTGG + Intergenic
907312303 1:53545889-53545911 ACAGGAGCCAGCGCATGGACCGG - Intronic
907464418 1:54625274-54625296 CCAGGAGCCAGGCCCTGGTGAGG + Intronic
909271270 1:73626846-73626868 TCAGGAGCTAGGTCCTGGAATGG - Intergenic
914917522 1:151827725-151827747 TCAGGAGCTGGGCCGTGGAGTGG + Intronic
915164229 1:153939673-153939695 TGAGCAGACAGGCCATGAAGCGG + Exonic
915591853 1:156875338-156875360 ACAGGAGCCAGCACAGGGAGAGG + Intronic
916520345 1:165557927-165557949 AAAGGAGCCAGGCCATGGGCAGG - Intronic
916557284 1:165904026-165904048 TCAGGAGCCAGACCATGGTTTGG - Intronic
916726261 1:167526583-167526605 TCAGGAGCCAGGGAATTGCGAGG - Intergenic
917179500 1:172279994-172280016 CCAGAAGCCAGACAATGGAGGGG - Intronic
917720119 1:177779390-177779412 AAAGGAGCCAGGCCATAGAAAGG + Intergenic
920085317 1:203411353-203411375 TCAGGAACCAGGCCAAACAGTGG - Intergenic
920960213 1:210656881-210656903 CCAGCAGCCAGCCCCTGGAGGGG - Intronic
922044374 1:221929041-221929063 CCAGGAGCCTGGTCTTGGAGTGG - Intergenic
922100610 1:222474606-222474628 GCAGGAGGCTGGGCATGGAGAGG + Intergenic
922824990 1:228511748-228511770 CCAGGGGCAAGGCCATGGTGAGG - Intergenic
922919107 1:229285635-229285657 TCAGGAGCAAGGGTAAGGAGTGG + Intronic
923155765 1:231278211-231278233 GCAGGAGCCAGCCCCTAGAGTGG + Intergenic
923325051 1:232873546-232873568 TCAAGAGCCATGCCATGGAGTGG - Intergenic
1066654507 10:37685843-37685865 CCAGGAGCCAGGCCAGGGAGAGG + Intergenic
1067039458 10:42941298-42941320 CCAGGAGCCGGGCCAGGGAGAGG + Intergenic
1068104061 10:52591862-52591884 TCAGGAGCTAGGGCCTGGAATGG + Intergenic
1070605962 10:77898720-77898742 TCAGGAGCCAGGCCATGGAGGGG - Intronic
1070833918 10:79436282-79436304 TCTGGAGCCAGGCCCTGGAGGGG - Intronic
1070955649 10:80461657-80461679 TCATCAGTCATGCCATGGAGGGG - Intronic
1071051177 10:81450674-81450696 CCAGGAGCCAGGGCTTGGACAGG + Intergenic
1071503413 10:86219141-86219163 CCAGGTGACAGGCCAGGGAGCGG - Intronic
1073054277 10:100689135-100689157 ACAGGAGCCTGTCCATGGCGGGG + Intergenic
1073352625 10:102830848-102830870 GCAGCAGCCAGGCCATGATGAGG + Exonic
1075016103 10:118910914-118910936 CAAGGAGCCAGGCCAGGCAGTGG + Intergenic
1075093035 10:119453988-119454010 TCAGGGGCCAGGCCAAGACGGGG - Intronic
1075425261 10:122337135-122337157 TCAGAAGCCAGGCCAGGCAGTGG - Intronic
1075541968 10:123321426-123321448 TCAGGAAGCAGGCCAAGGTGAGG - Intergenic
1075719485 10:124576515-124576537 TCTGGGGGCAGGCCATGGAGGGG - Intronic
1075724781 10:124605707-124605729 TGAGGAGCCAGGCTATGATGTGG + Intronic
1076789399 10:132768659-132768681 TCAGGGGCCAGGCCGTGGCAAGG - Intronic
1076814828 10:132909573-132909595 CCAGGAGCCAGGCCCTAGTGGGG - Intronic
1076834963 10:133016402-133016424 GCAGGGTCCAGGCCAGGGAGCGG + Intergenic
1077316720 11:1922613-1922635 TCTGGAGCCAGGGCAGGAAGAGG + Intronic
1077441064 11:2569504-2569526 TCAGAAGCCGGGCCCTGGAGGGG - Intronic
1078154792 11:8790151-8790173 TAAGGAGACAGGGCAGGGAGGGG - Intronic
1078693332 11:13603846-13603868 ACAGGAGCCAGGCCAGGGATGGG + Intergenic
1078830098 11:14970226-14970248 TCAGGACCCAGGCACTGGTGTGG + Intronic
1078899073 11:15624597-15624619 TCAGCACCCTGGCCATGGTGCGG - Intergenic
1081781492 11:45716195-45716217 TAAGGAGGCAGGTCAGGGAGTGG - Intergenic
1081867146 11:46366289-46366311 GAAGGTGCCAGGCCCTGGAGAGG + Exonic
1083335605 11:61920012-61920034 TCAGGACCTGGGGCATGGAGGGG - Intronic
1083778398 11:64905908-64905930 GCAGGGGCCAGGACAGGGAGGGG - Intronic
1084125349 11:67095559-67095581 TCAGGGGACAGGGCAGGGAGAGG - Intergenic
1084531551 11:69730702-69730724 GCAGGAGCCAGGACAGAGAGGGG + Intergenic
1086327969 11:85724242-85724264 TCAGGAACCTGGCTTTGGAGAGG - Intronic
1087611161 11:100435337-100435359 TCAGGTTCCAGCCCATGCAGAGG - Intergenic
1089131731 11:116217696-116217718 TCATGGGCCAGGCCTAGGAGGGG + Intergenic
1089168771 11:116498345-116498367 TGAGGAGCCAGGCCATGCTGGGG - Intergenic
1089399879 11:118158186-118158208 CCAAGGGCCAGGCCATGTAGGGG + Intergenic
1090352014 11:126113846-126113868 GCAGCAGGCAGGCCAGGGAGAGG + Intergenic
1092145279 12:6210419-6210441 TCAGGACAAAGGCCAGGGAGAGG + Intronic
1092193014 12:6533906-6533928 CCAGGAGCCAGGAGATGGGGAGG + Exonic
1092236973 12:6816405-6816427 TGAGGGGCCAGGCCAGGGAGGGG + Intronic
1092407321 12:8230118-8230140 TCAGGAGCCAGCTCCTGGATGGG + Intergenic
1093065397 12:14652874-14652896 TCAGGGGCCAGGGCAATGAGGGG + Intronic
1094719538 12:33049252-33049274 GCAGGAGTCAGACCATGGATGGG + Intergenic
1096174571 12:49504446-49504468 TAAGGAGGCAGGATATGGAGTGG + Intronic
1096700995 12:53382656-53382678 TTATTAGCCAGGCCTTGGAGGGG - Exonic
1097030797 12:56087922-56087944 TCAGAACCCAGGCAATGGAAAGG - Intronic
1099271064 12:80511849-80511871 TCAGGAGTCAAGCCATGGTAAGG + Intronic
1101741953 12:107507610-107507632 GCAGGGGCCAGATCATGGAGGGG - Intronic
1102554646 12:113719035-113719057 ACAGGAGCTGGGCCCTGGAGGGG - Intergenic
1102966802 12:117134073-117134095 TCCAGAGCCAGGCCGTGGATTGG - Intergenic
1103360647 12:120351493-120351515 TGAGGAGACAGGCCATGCACAGG + Intronic
1103990363 12:124795083-124795105 CCAGGAACCAGGGCATGGGGAGG - Intronic
1113051892 13:106221441-106221463 TAATGAGCAAGGCCAAGGAGAGG - Intergenic
1113786768 13:113006187-113006209 TCAACAGCGAGGCTATGGAGAGG - Intronic
1115193369 14:30770490-30770512 TTGGGAGCCAGGCCATGCATCGG - Intergenic
1116143865 14:41037893-41037915 GCATGTGCCAGGCCATGGATGGG + Intergenic
1117063151 14:51983203-51983225 TGAGGAGGGAGGCCATGGTGTGG - Intergenic
1117244828 14:53874442-53874464 TTTGGAGCCAGGCCTAGGAGTGG - Intergenic
1117833810 14:59780967-59780989 GCAGGTGCCATGCCCTGGAGTGG - Intronic
1118503430 14:66385605-66385627 TCTGGAGCCAGGCTCTGCAGGGG + Intergenic
1118966791 14:70594727-70594749 ACAGGAGCCTGGCCATGGGATGG + Intronic
1119297268 14:73543103-73543125 TCAGGAAAGAGGCCATGGAAAGG - Exonic
1119301499 14:73574961-73574983 TCAGGAAAGAGGCCATGGAAAGG - Exonic
1120011793 14:79423922-79423944 TCAGAAGCCAAGCAATGAAGAGG - Intronic
1121607695 14:95253356-95253378 ACAGTACTCAGGCCATGGAGCGG - Intronic
1121997923 14:98619415-98619437 TGAGAAGCCAAGCCATGGACTGG + Intergenic
1122294283 14:100696409-100696431 GCACGAGCCAGGCCAGGGAGAGG + Intergenic
1122408563 14:101514420-101514442 GCTGGAGCCTGGACATGGAGGGG - Intergenic
1122982638 14:105198541-105198563 ACAGGAGCAAGGCTCTGGAGTGG + Intergenic
1123023805 14:105414403-105414425 GCAGGAGGGAGGCAATGGAGAGG - Intronic
1123065715 14:105618226-105618248 CCAGGCGCCAGGCCCTGCAGGGG + Intergenic
1123069879 14:105637471-105637493 CCAGGCGCCAGGCCCTGCAGGGG + Intergenic
1123089113 14:105734259-105734281 CCAGGCGCCAGGCCCTGCAGGGG + Intergenic
1123094900 14:105762416-105762438 CCAGGCGCCAGGCCCTGCAGGGG + Intergenic
1123529317 15:21131022-21131044 TTAGGTGCCAGACCATGGGGAGG + Intergenic
1124222220 15:27860912-27860934 GCAGCAGCCAGGCCTAGGAGAGG + Intronic
1124341733 15:28894339-28894361 TCAGGAGGGAGGGCATGGAGGGG + Intronic
1124965444 15:34429628-34429650 TCAGGAGGAAGGGCATGGAAGGG - Intronic
1124982063 15:34575830-34575852 TCAGGAGGGAGGGCATGGAAGGG - Intronic
1125318132 15:38454272-38454294 TAAGCAGCCAGGCCAAGGAGAGG - Intronic
1125599230 15:40906553-40906575 CCAGGAGCCAGGGTAGGGAGCGG - Intergenic
1126420753 15:48469755-48469777 ACAGGGTACAGGCCATGGAGAGG + Intronic
1127014896 15:54673520-54673542 TCAACAGGCAGCCCATGGAGTGG + Intergenic
1127561169 15:60137838-60137860 TCAGGGGCCAAGCCATGGAGGGG - Intergenic
1128308439 15:66615291-66615313 TCCGGAGCCAGGCAGAGGAGGGG + Intronic
1129030662 15:72615503-72615525 TCAGGAGCTAGGTCCTGGAATGG + Intergenic
1129119958 15:73390153-73390175 TCAGGAGCCATCCAATGAAGAGG - Intergenic
1129178836 15:73858947-73858969 TCAGGAGCCACGGCATGGGTTGG - Intergenic
1129233565 15:74209874-74209896 TCAGGAGAAGGGCCCTGGAGAGG + Intronic
1129477508 15:75796018-75796040 TCAGGAGCTAGGTCCTGGAATGG + Intergenic
1129774886 15:78230116-78230138 TCAGGACCCAGGCCCTGGGCAGG + Intronic
1129944013 15:79523770-79523792 ACAGAAGCTGGGCCATGGAGTGG + Intergenic
1129944120 15:79524430-79524452 GCAGAAGTCAGGCCATGGCGTGG + Intergenic
1130897303 15:88181458-88181480 TCAGGACCCAGGCTCAGGAGTGG - Intronic
1130937552 15:88482964-88482986 TCAGGAGCCAGGAACTGGATTGG + Intergenic
1131440128 15:92453664-92453686 TTAGGTGCCAGGCCAGAGAGGGG + Intronic
1131457389 15:92593086-92593108 TCAGGAGCCAAGTCACGCAGGGG - Intergenic
1132114419 15:99125190-99125212 TGAGGAGCCAGGGCAGGGCGTGG - Intronic
1133347996 16:5083228-5083250 TCAGGAGCCGGCCCCTGGATGGG + Intronic
1133901403 16:9978619-9978641 ACTTGAGCCAGGTCATGGAGTGG - Intronic
1136720977 16:32319562-32319584 TTAGGTGCCAGACCATGGGGAGG + Intergenic
1136839362 16:33525848-33525870 TTAGGTGCCAGACCATGGGGAGG + Intergenic
1138096483 16:54215711-54215733 ACATGAGCCAGGCCAGGGAGTGG - Intergenic
1138554450 16:57763586-57763608 GCAGGTGGCAGGCCAGGGAGAGG - Intronic
1139549123 16:67663802-67663824 GCAGGAGCCAGGCCTGGGGGTGG - Exonic
1140357851 16:74321199-74321221 TCAGGAACCAGGGAATGGAAGGG + Intergenic
1141869025 16:86771955-86771977 ACGGGGGCCAGGACATGGAGTGG + Intergenic
1141883421 16:86874865-86874887 TCAGCAGCCAGGCTTAGGAGCGG + Intergenic
1142226036 16:88878053-88878075 GCAGGGGCCAGGGCCTGGAGCGG - Intronic
1142235086 16:88918322-88918344 ACAGGGCCCAGGCCATGGTGGGG - Intronic
1142260077 16:89038738-89038760 ACAGGGTCCAGGCCTTGGAGAGG + Intergenic
1203005455 16_KI270728v1_random:198208-198230 TTAGGTGCCAGACCATGGGGAGG - Intergenic
1203137005 16_KI270728v1_random:1734329-1734351 TTAGGTGCCAGACCATGGGGAGG - Intergenic
1203149527 16_KI270728v1_random:1826133-1826155 TTAGGTGCCAGACCATGGGGAGG + Intergenic
1142804482 17:2364206-2364228 CCAGGAGCCAGGGCAGGGAGTGG + Intronic
1143553524 17:7646380-7646402 TCAGGAGGCTGGCCTTGGACTGG - Intergenic
1143972813 17:10807817-10807839 TTAGGATCCAGGTCATGGAGAGG - Intergenic
1144458015 17:15434761-15434783 CGAGCAGCCAGGGCATGGAGTGG - Intergenic
1144828156 17:18118105-18118127 TCAGAAGGCAGGGCAAGGAGGGG - Intronic
1145064213 17:19751047-19751069 CCAGGAGCCAGGCCAGGCAGGGG - Intergenic
1146903328 17:36602008-36602030 GCAGGAGCCGGGCCACAGAGCGG - Exonic
1147375275 17:40019313-40019335 TCAGGTGCCAGCAGATGGAGAGG + Exonic
1147470716 17:40658045-40658067 TCAGAAGCCAGGTCAGGTAGAGG + Intronic
1148842876 17:50510049-50510071 TCAGGGGCCAGACCATGAAAGGG + Intronic
1149076535 17:52602078-52602100 CCAGGCCCCAGGCCATGGACAGG - Intergenic
1150148076 17:62787386-62787408 TCAGGATCCATGCCATTGATAGG + Intronic
1151700628 17:75740774-75740796 TCAGCTGCCAGGCAAGGGAGGGG - Exonic
1152284863 17:79406486-79406508 ACAACAGCCAGGCAATGGAGAGG - Intronic
1152681052 17:81668095-81668117 TCAGGATCCATGCTAAGGAGCGG + Intronic
1152717257 17:81906066-81906088 CCAGGAGCCAGCCCAAGGATGGG - Intronic
1152734571 17:81991167-81991189 TCATGAGCTCAGCCATGGAGGGG + Intronic
1152929421 17:83102258-83102280 ACAGGCACCAGGCCATGGTGGGG - Intergenic
1154414956 18:14171600-14171622 ACCAGAGCCAGGCCATAGAGAGG + Intergenic
1154446227 18:14437893-14437915 GACGGACCCAGGCCATGGAGGGG - Intergenic
1155355919 18:24954092-24954114 CCAGGAGCAATGCCTTGGAGCGG + Intergenic
1156218746 18:35029432-35029454 TCAGAACCCAGGCCATCAAGTGG - Intronic
1157065280 18:44342164-44342186 TCAGGAGCTAGGGCCTGGAATGG + Intergenic
1157397470 18:47354911-47354933 GCAGGAGCCAGGTAATTGAGGGG + Intergenic
1157639040 18:49194039-49194061 TGACGTGCCAGGGCATGGAGTGG + Intronic
1158427135 18:57350735-57350757 TCAGGAAACATGCTATGGAGAGG - Intergenic
1158655215 18:59324682-59324704 CCAGGAGCCAGTCCATGGAGTGG - Intergenic
1159080590 18:63731288-63731310 CCAGGAGCCAGGTCCTGGAACGG - Intergenic
1159638651 18:70837342-70837364 TCAGAAGCCTGGGCATGGTGTGG + Intergenic
1160492074 18:79347067-79347089 ACAGGAGGGAGGCCATGGAAAGG - Intronic
1160839978 19:1142063-1142085 TGAGGAGGGAGGCCATTGAGGGG - Intronic
1161103436 19:2432476-2432498 TCAAGAGGCAGGTCTTGGAGGGG - Exonic
1161167205 19:2794669-2794691 TCAGCAGACAGGCCTGGGAGAGG + Intronic
1161226446 19:3148720-3148742 CCATGATCGAGGCCATGGAGCGG + Exonic
1161480034 19:4505833-4505855 TTAGGAGCCTGGCCTTGGACAGG - Intronic
1162050193 19:8028318-8028340 TCAAGAGCCAGGCCCTGCACTGG - Intronic
1162156500 19:8681606-8681628 TGGGGAGGAAGGCCATGGAGGGG + Intergenic
1164979518 19:32603300-32603322 TAAGGAGCCTGTCCATGGAGTGG + Intronic
1165086514 19:33352145-33352167 TCAGGAGCAAAGCCATTGACAGG - Intergenic
1165905786 19:39193892-39193914 TCAGAATCCAGGGCAGGGAGTGG - Intergenic
1166672391 19:44718800-44718822 TCTGGAGCCCTGCCAGGGAGAGG + Intergenic
1166823577 19:45595677-45595699 TCAGGAGCCATTCCATCCAGGGG + Intronic
1167006432 19:46779048-46779070 TCAGGGGCCAGGCCTGGGAGTGG - Intronic
1167293571 19:48636986-48637008 GCAGGTGCCAGGCGATGGCGCGG - Exonic
1167645837 19:50704321-50704343 CAAGGAGACAGGCCGTGGAGGGG - Intronic
1167664802 19:50817894-50817916 TCAGGAGCCCTGCAATGGGGTGG - Intergenic
1167690568 19:50982133-50982155 ACAGGAGGCAGGGCCTGGAGGGG + Intronic
925239716 2:2313379-2313401 TCAGGAGTCAGTCTCTGGAGAGG + Intronic
925338259 2:3114658-3114680 TCAGGGGCCAGGTCATTGAGAGG + Intergenic
925401323 2:3575409-3575431 TTTGGAGTCAGGCCCTGGAGGGG + Intronic
925609361 2:5691473-5691495 TCCGGAGCCAGCCCTGGGAGTGG + Intergenic
925633985 2:5924746-5924768 CCAAGAGCCAGGCCTTTGAGGGG + Intergenic
925792863 2:7510594-7510616 GCAGGAGCCACGCCCTAGAGAGG - Intergenic
925906128 2:8540546-8540568 ACAGGAGTCTGGCCATGAAGTGG + Intergenic
925969170 2:9095141-9095163 TGGGGAGCCAGGCCAGAGAGTGG + Intergenic
927649956 2:24906527-24906549 GCTGGAGCCAGCCCAAGGAGTGG - Intronic
928181499 2:29071654-29071676 CCAGGAGCCAGGGCCGGGAGAGG - Exonic
929114660 2:38434081-38434103 TCAGGACACAGGCTCTGGAGAGG - Intergenic
931684930 2:64784824-64784846 TCAGGAGGCAGCCCAGGCAGAGG - Intergenic
931909338 2:66879859-66879881 TCAGCTCCCAGGCCATGGACTGG + Intergenic
932093430 2:68826485-68826507 TCAGGACCCAGGCAATAGACTGG + Exonic
933709925 2:85317330-85317352 TCAGGAGTCAGGGCATCGACTGG + Intergenic
933713139 2:85342414-85342436 TCAGGAGTCAGGGCATGGACTGG - Exonic
934274150 2:91564713-91564735 ACCAGAGCCAGGCCATAGAGAGG + Intergenic
934562282 2:95319603-95319625 TAAGGAGCCAGGCCAAGGGCGGG - Intronic
935674653 2:105584303-105584325 TCTGGAGCAAGGTCATGGACTGG + Intergenic
935716372 2:105942758-105942780 TCAAGCCCCAGGCCATGGACTGG - Intergenic
936148296 2:109996435-109996457 TTAGGTGCCAGACCATGGGGAGG + Intergenic
936196381 2:110374933-110374955 TTAGGTGCCAGACCATGGGGAGG - Intergenic
936239337 2:110773560-110773582 TCAGGAGCCAGTCCTGGGATGGG - Intronic
936624639 2:114135623-114135645 TCCGGAGTGAGGACATGGAGAGG - Intergenic
936714620 2:115171532-115171554 TCAGGAAACAGACAATGGAGAGG + Intronic
936893189 2:117395905-117395927 TTAGGTACCAGGCCTTGGAGAGG + Intergenic
937434476 2:121869154-121869176 TCAGACTCCAGGCCATGGGGAGG + Intergenic
937557981 2:123183174-123183196 TCAAGAGACAGCCCATGGAATGG + Intergenic
938105102 2:128524718-128524740 TCAGGACACAGGCCATATAGAGG + Intergenic
938118605 2:128618666-128618688 TCAAGAGCCAGGCCTAGGAATGG - Intergenic
939818856 2:146930824-146930846 TCAGGTGGCTGGACATGGAGAGG + Intergenic
946410800 2:219514251-219514273 TCAGGAGCCAGGCCAGGGGAGGG - Intronic
946430910 2:219627187-219627209 ACAGAAGCCAGGCCTTTGAGAGG + Intergenic
947632551 2:231663446-231663468 AGAGGAGGCAGGTCATGGAGAGG + Intergenic
948466231 2:238153062-238153084 CTGGGAGCCAGGCCCTGGAGAGG - Intergenic
948553810 2:238793925-238793947 TCAGGAGGGAGGGCGTGGAGGGG - Intergenic
948754048 2:240149034-240149056 TCAGGGGACAGTCTATGGAGGGG - Intergenic
948952400 2:241262647-241262669 TCAGGAGCCGGGTAATGGAACGG + Intronic
1168893429 20:1308566-1308588 TCAGGTGCCATGCCCTGAAGAGG + Exonic
1168953668 20:1819559-1819581 TGAGGAGACAGGCGAAGGAGAGG - Intergenic
1168961902 20:1875825-1875847 TCAGAACCCAGGCCTTGGGGTGG + Intergenic
1169417900 20:5433199-5433221 TCAGAAGCCAGCCCAGGGAGTGG - Intergenic
1169800118 20:9506058-9506080 TAAGGAGGTAGGCCTTGGAGCGG + Intergenic
1170815557 20:19710952-19710974 TTGGGAGACAGGCCATGGTGAGG - Intronic
1171084016 20:22219331-22219353 TGAGGGGCCGGGGCATGGAGTGG - Intergenic
1171337862 20:24402455-24402477 ACAGGAACCAAGCCATGGATGGG + Intergenic
1171453839 20:25255417-25255439 CCACCAGCCAGGCCTTGGAGCGG - Intronic
1172025562 20:31945935-31945957 TCTGGAGCCAGGCCCAGGAAAGG + Intronic
1172787578 20:37479384-37479406 ACAGGGTCCTGGCCATGGAGTGG + Intergenic
1173204261 20:40980243-40980265 CCAGGAGCTAGGCCCTGGAATGG + Intergenic
1174295078 20:49540034-49540056 TCAGGTGCCAGGTGAGGGAGGGG + Intronic
1174322508 20:49753059-49753081 AGAGGAGCCAGACCAGGGAGAGG + Intergenic
1174339640 20:49887772-49887794 TCAGGGGCAGGGCCATGGAAGGG - Intronic
1174353776 20:49985314-49985336 TCAGGCGCCAGGCCAGGAAATGG - Intronic
1175182976 20:57161537-57161559 TCAGGAGCCTGTCCAGGCAGGGG + Intergenic
1175371751 20:58497062-58497084 TGAGGAGTGAGGCCATGCAGGGG + Intronic
1176430627 21:6573477-6573499 TCAGGAGTCACAGCATGGAGTGG - Intergenic
1176449755 21:6851953-6851975 GATGGACCCAGGCCATGGAGGGG + Intergenic
1176827927 21:13716977-13716999 GATGGACCCAGGCCATGGAGGGG + Intergenic
1178981630 21:37269461-37269483 ACAGAAGCCAGGCCTTGCAGAGG - Intergenic
1179706021 21:43180939-43180961 TCAGGAGTCACAGCATGGAGTGG - Intergenic
1179718508 21:43302371-43302393 TGAGGGGCAAGGCCAAGGAGAGG + Intergenic
1179925810 21:44533539-44533561 TCAGGAGCCATGGGGTGGAGGGG - Intronic
1180232563 21:46436127-46436149 TCACCAGCCAGGCCGTGGACAGG + Exonic
1180551793 22:16546748-16546770 TTAGGTGCCAGACCATGGGGAGG - Intergenic
1181012156 22:20047674-20047696 CCAGGACCCAGCCCAGGGAGTGG - Intronic
1181084763 22:20434678-20434700 TCAGAAGCCAGGCCATAGGCTGG + Intronic
1181352213 22:22267175-22267197 TTAGGTGCCAGACCATGGGGAGG + Intergenic
1181392427 22:22593456-22593478 GCAGGAGGCAGGGCAGGGAGGGG + Intergenic
1181638490 22:24185121-24185143 TCAGGTGCCAGGCCAGTGCGTGG - Exonic
1182280919 22:29217273-29217295 CCAGGAGCCAGGCCAAGGGCTGG + Intronic
1182668305 22:31974836-31974858 GAAGGAGCCAGGCAATGGAAGGG + Intergenic
1183489198 22:38107822-38107844 TCAGGCCCCAGGGCCTGGAGGGG - Intronic
1183539139 22:38419486-38419508 TCAGGAGCCTGGCTCTGGATAGG + Intergenic
1183949735 22:41346151-41346173 TCAGGAGCTTGGCGATGGTGAGG - Exonic
1184111379 22:42397592-42397614 TGAGGATCCATGCCAAGGAGGGG + Intronic
1184170147 22:42754027-42754049 TCAGGAGGCTGCCCATGGTGTGG + Intergenic
1184762137 22:46550673-46550695 TCGGGAGCTGGGCCATGGAGGGG + Intergenic
1185278110 22:49958515-49958537 CCAGCAGCCTGGCCCTGGAGTGG - Intergenic
1185330419 22:50249750-50249772 CCAGGAGCCCGGCCAGGGATGGG + Intronic
949547094 3:5081607-5081629 TCAGAAGCCAGCCCAGGAAGAGG - Intergenic
952956654 3:38561983-38562005 CCAGGAGGCAGGGCATGCAGAGG + Intronic
952966115 3:38622329-38622351 TCAGGAGCCATGGCATGGAATGG + Intronic
953404241 3:42652762-42652784 TCAGGAGCCAGGGGAAGGGGAGG - Intergenic
953581975 3:44165886-44165908 TCAAGAGTCAGGCCATGGGCTGG + Intergenic
953677680 3:45016032-45016054 TCTGGAGCAAGGCCATGTGGTGG + Intronic
953881323 3:46692861-46692883 TAAGGAGCCAGGCCTGGGAGAGG - Intronic
954142869 3:48619128-48619150 TAAGAAGCCAGACCATGTAGGGG + Intergenic
954786663 3:53098447-53098469 TCAGAAGCCTGGCCATGGGGTGG - Intronic
955391378 3:58524735-58524757 TCAGGAGGGAGGCCAGGCAGAGG - Intronic
955441056 3:58955893-58955915 CCAGGAGCCAGGGCCTGGAAAGG - Intronic
955610566 3:60752424-60752446 GCAGCAGCAGGGCCATGGAGTGG + Intronic
957494216 3:80969676-80969698 TCTGGAGCAATGCCATGGAGTGG + Intergenic
957624176 3:82637707-82637729 TGAGGACGCAAGCCATGGAGAGG - Intergenic
958149121 3:89667817-89667839 TCAGGATTCAGGCCAATGAGGGG - Intergenic
959336046 3:105066506-105066528 CTAGGAGCCAGGGCCTGGAGTGG - Intergenic
959457449 3:106580408-106580430 GCAAGGGCCAGGCCATGCAGGGG + Intergenic
960640060 3:119815505-119815527 TGAGGAGCAAGGCCATAGACTGG - Intronic
961039443 3:123666940-123666962 CCAGGAGCCAGGCTGTGCAGAGG + Intronic
961885985 3:130096722-130096744 TCAGGAGCCGGCCCCTGGATGGG + Intronic
962015114 3:131431444-131431466 TCAGGAGCTAGGGCCTGGAATGG - Intergenic
962903454 3:139780556-139780578 TCAGTAGCAAGGACTTGGAGAGG + Intergenic
963528374 3:146443010-146443032 TAAGGAGACAGCCCATGGATTGG + Intronic
965569887 3:170161651-170161673 TCAGGGGTCAGGCCATGGAACGG - Intronic
965844584 3:172946707-172946729 CCATGAGCCAGGGCCTGGAGAGG - Intronic
966290213 3:178346967-178346989 TCAAGAGACAGACCATGGAATGG + Intergenic
967626833 3:191696309-191696331 TCACTACCCTGGCCATGGAGGGG + Intergenic
967878144 3:194280737-194280759 AGAGGAGCCAGGGTATGGAGTGG - Intergenic
968641797 4:1718501-1718523 TCAGGATGCAGGCGATGGAGGGG + Exonic
968977837 4:3831085-3831107 ACAGGAGGCAGGGCAGGGAGCGG + Intergenic
969058672 4:4417965-4417987 TCAGGAGTCAGCACAGGGAGGGG - Exonic
969430293 4:7150013-7150035 TCAGGAGCAGACCCATGGAGAGG + Intergenic
969818794 4:9705396-9705418 TCAGGAGCCGGCCCCTGGATGGG - Intergenic
974292347 4:59948658-59948680 CCAGGAGCCAGGGCCTGGAATGG - Intergenic
975080866 4:70278982-70279004 TCAGGACCAAAACCATGGAGAGG + Intergenic
975622929 4:76312107-76312129 TCTGCATCCAGCCCATGGAGGGG + Intergenic
977365626 4:96064412-96064434 TTAGGAGCCAGGCCCTGGGGTGG + Intergenic
977521797 4:98094222-98094244 TCAGGAGCTAGGGCCTGGAATGG - Intronic
977671250 4:99698163-99698185 TCAGGAGCCATCTCAAGGAGAGG + Intergenic
977864034 4:102001758-102001780 TCAGAAGCCAGGACCTGCAGGGG + Intronic
978579799 4:110220414-110220436 TCAGCAGACAGGGGATGGAGTGG + Intergenic
980591145 4:134891020-134891042 TCAGGAGCCAGCCAAGGGACAGG + Intergenic
980977517 4:139625293-139625315 TCAGGAGCAGGGCCATGCGGGGG - Intergenic
981518397 4:145634848-145634870 TCAGGAGCTAGGGCCTGGAAGGG + Intronic
983519938 4:168697588-168697610 CCAGGTGACAGTCCATGGAGGGG - Intronic
983679950 4:170341948-170341970 CCAGGCCCCAGGCCATGGACTGG + Intergenic
984461421 4:180041434-180041456 TCAAGCCCCAGGCCATGGACTGG - Intergenic
987180855 5:15367076-15367098 TCTGGAGCCAAGCCTTTGAGAGG - Intergenic
990724627 5:58740129-58740151 TCAGGAGCCAGGCCAGGCAGGGG + Intronic
991953108 5:71965937-71965959 CCAGGAGCCAGGGGATGGAAGGG - Intergenic
993794372 5:92248943-92248965 TGAGGGGACTGGCCATGGAGTGG - Intergenic
995403272 5:111765318-111765340 TTAGGAACCAGGCCATACAGCGG - Intronic
995597336 5:113762198-113762220 TCCTGAGCCAGGCAAGGGAGGGG - Intergenic
998418830 5:141965334-141965356 TCGGGACCCAGGCCACGGAGTGG - Intronic
999277123 5:150338826-150338848 TCAGGAGCCAGACCAGGCCGAGG - Intronic
999365423 5:151020648-151020670 GCAGCAGCCGGGCCATGGCGGGG - Exonic
999919563 5:156303752-156303774 TCAGGAGCTAGGGCCTGGAATGG + Intronic
1001471824 5:172019422-172019444 TGAGGAGCCAGAACATGAAGTGG - Intergenic
1002615689 5:180454305-180454327 TCAGGAGTGAGGCAAAGGAGAGG + Intergenic
1002628252 5:180548565-180548587 ACAGGAGGCAGCCCAAGGAGGGG - Intronic
1003122165 6:3327237-3327259 ACAGTAGCCAGGCCCTGAAGGGG - Intronic
1004301012 6:14457092-14457114 TGAGGAGCCAAGGCATAGAGAGG - Intergenic
1006143633 6:31945560-31945582 TCTGGGGACAGGCCAAGGAGCGG - Exonic
1006455502 6:34129690-34129712 CCAGGAGTCAGGCCTGGGAGAGG + Intronic
1006486518 6:34347281-34347303 TCATGAGCCAGGAACTGGAGAGG + Intronic
1007397234 6:41584925-41584947 GGAGGAGCCAGGCCAGGCAGAGG - Intronic
1007418037 6:41703417-41703439 GCAGGAGCCAGGCACTGGCGGGG - Intronic
1007519459 6:42440317-42440339 TCAGGAGCCAGTCTTTGGAGCGG + Intronic
1007741604 6:44013176-44013198 TCAGGAGCCAGGATATGGCCTGG + Intergenic
1007929584 6:45678330-45678352 TCCACAGCCAGGCCAAGGAGCGG - Intergenic
1007950322 6:45866464-45866486 TCAACAGCCAGTTCATGGAGTGG - Intergenic
1008880710 6:56377921-56377943 TCAGGAGCTAGGGCCTGGAACGG - Intronic
1011291203 6:85779203-85779225 TCAGGACCCAGGGCCTGGAATGG + Intergenic
1012438672 6:99241684-99241706 CCAGGAGCCTGAACATGGAGAGG - Intergenic
1015044622 6:128762440-128762462 GCAGGAGCCATGGCATGGTGAGG - Intergenic
1016355598 6:143214807-143214829 GCAGGTGCCAAGACATGGAGGGG - Intronic
1017615822 6:156245344-156245366 TCAGGAGCCACTCAATGGAGTGG + Intergenic
1019648131 7:2141824-2141846 CCGGGAGCCAGGCCATGTGGAGG - Intronic
1020319433 7:6929189-6929211 TCAGGAGCCGGCTCATGGATGGG + Intergenic
1020413218 7:7916036-7916058 GCAGCAGCCAGCTCATGGAGAGG + Intronic
1021597170 7:22329747-22329769 TCAGGATCCAGCCCATGCTGAGG + Intronic
1022465884 7:30653057-30653079 CCAGCAGCCAGGCAATGGTGTGG - Intronic
1023142718 7:37118272-37118294 CCAGGAGTCAGACCATAGAGTGG - Intronic
1023662980 7:42489658-42489680 TAAGGACCCAGGCCTGGGAGAGG + Intergenic
1024530138 7:50384486-50384508 TCAGCAGGGGGGCCATGGAGTGG + Intronic
1025206373 7:56995682-56995704 TCTGGGGCCAGGCCGGGGAGGGG + Intergenic
1025665562 7:63581245-63581267 TCTGGGGCCAGGCCGGGGAGGGG - Intergenic
1025914177 7:65852392-65852414 TCAAGAGACTGGACATGGAGGGG + Intergenic
1026129390 7:67607502-67607524 ACAGAAGTAAGGCCATGGAGGGG + Intergenic
1026156875 7:67834044-67834066 GCAGGTGCCAAGCCAAGGAGAGG + Intergenic
1027443177 7:78242192-78242214 TTAGGAGCCAGCCCAGGAAGGGG - Intronic
1029117201 7:98243432-98243454 TGGGGAGCCAGGGCAGGGAGAGG + Intronic
1029337612 7:99915722-99915744 TCAGGAGCCAGGTCACTGGGCGG - Intronic
1030099519 7:105933264-105933286 TGAGGACCCTGGCGATGGAGAGG - Intronic
1030662701 7:112238757-112238779 CCAGGAGCCAGGGCCTGGAATGG - Intronic
1032077750 7:128844116-128844138 GCTGGAGCCAGGCGGTGGAGCGG + Exonic
1033436721 7:141339459-141339481 TCAGAAGTCAGGCCAAGCAGGGG + Intronic
1034035494 7:147816224-147816246 CCAGGAGCCCTGCCTTGGAGAGG + Intronic
1034227374 7:149494459-149494481 CCACGATTCAGGCCATGGAGAGG - Exonic
1034242552 7:149621515-149621537 CCACGATTCAGGCCATGGAGAGG - Intergenic
1034550961 7:151820437-151820459 ACAGGGGCCAGGCCACGGAGCGG - Intronic
1034550973 7:151820491-151820513 ACAGGGGCCAGGCCACGGAGCGG - Intronic
1034550985 7:151820545-151820567 ACAGGGGCCAGGCCACGGAGCGG - Intronic
1034550997 7:151820599-151820621 AGAGGGGCCAGGCCACGGAGCGG - Intronic
1034745846 7:153523513-153523535 TCGGGAGCCTGGGCATGGGGAGG + Intergenic
1035307978 7:157945482-157945504 TCAGGGGCCAGGTCACTGAGCGG - Intronic
1035817779 8:2559923-2559945 TGAGGAGACAGGGCATGCAGAGG - Intergenic
1036289104 8:7471698-7471720 GCAGGAGCCAGGCTTGGGAGAGG + Intronic
1036332371 8:7839829-7839851 GCAGGAGCCAGGCTTGGGAGAGG - Intronic
1036703969 8:11032751-11032773 GCAGGAGGCAGGGCTTGGAGGGG - Intronic
1036746239 8:11412141-11412163 TGGGAACCCAGGCCATGGAGGGG - Intronic
1038364311 8:26915611-26915633 TCGGGCACCAGGCCATGGAGCGG - Intergenic
1039647495 8:39303661-39303683 TCAGGAGCCATGACCTGGAAAGG + Intergenic
1040010325 8:42656369-42656391 GCCAGAGCCAGGGCATGGAGAGG - Intergenic
1044149542 8:88757977-88757999 TTAGGAGTCAGGTCAGGGAGGGG + Intergenic
1045395661 8:101758308-101758330 GCAGGAGACAGCCTATGGAGGGG - Intronic
1045694690 8:104795119-104795141 TCAGGGGCCAGGCCTGGGGGTGG + Intronic
1047318159 8:123753575-123753597 ACAGGAGCCAGATCAGGGAGTGG - Intergenic
1047991779 8:130293881-130293903 TCAGCAGCCAGGCCATTGCAAGG - Intronic
1048195985 8:132332172-132332194 CCATGAGGCAGCCCATGGAGAGG + Intronic
1048935952 8:139357264-139357286 TCAGGAGCCAGGCCCTGGGGTGG - Intergenic
1049401340 8:142428818-142428840 CCTGGAGCCAGGCCTTGGACAGG + Intergenic
1049505440 8:142994064-142994086 GCTGGAGGCAGGCCCTGGAGTGG + Intergenic
1050200330 9:3138692-3138714 TCAGGACGTTGGCCATGGAGTGG + Intergenic
1050949254 9:11567099-11567121 TCAGGAGCTAGGTCCTGGAATGG + Intergenic
1052248348 9:26366154-26366176 TCACAAGCCAGGCCTTGGACAGG + Intergenic
1052554369 9:29994952-29994974 CAATGAGCCAGGCAATGGAGTGG + Intergenic
1057433902 9:95021830-95021852 TCAGGAGCCATCCCAGGGAGAGG + Intronic
1058759220 9:108113832-108113854 TCATGAGTCAGGCCATGGACAGG - Intergenic
1059573245 9:115463010-115463032 TCAGGAGCCAGACCATGGAAGGG + Intergenic
1059642690 9:116233014-116233036 GCAGGAGAAAGCCCATGGAGGGG + Intronic
1060967527 9:127720260-127720282 CCAGGAGACAGGCCATGCTGAGG - Exonic
1061926416 9:133808173-133808195 TCAGAAGCCAGGGCATGGGCAGG + Intronic
1062039753 9:134398830-134398852 TCAGAAGCCGGGCCTTGGAATGG - Intronic
1062284604 9:135767513-135767535 AGAGTAGCCAGGCCAGGGAGCGG + Intronic
1062285962 9:135772597-135772619 ACAGGAGCCAGGCCATGACAGGG + Intronic
1062450684 9:136614508-136614530 TCACCAGCCAGGCCAGGAAGTGG + Intergenic
1062696970 9:137880501-137880523 CCAGGAGCCAGGCCGGGGCGGGG + Intronic
1203519429 Un_GL000213v1:32564-32586 GATGGACCCAGGCCATGGAGGGG - Intergenic
1185636841 X:1559170-1559192 TCAGGAGCCCGGCAATGGTTAGG - Intergenic
1186223701 X:7375532-7375554 ACAGGAGGGAGGCCAAGGAGTGG - Intergenic
1187655169 X:21463744-21463766 TCAGGAGCTAGGGCCTGGAAAGG + Intronic
1187844880 X:23524898-23524920 CCAGGAGCTAGGGCCTGGAGAGG - Intergenic
1188668336 X:32852241-32852263 TCAGGAGCCAGGGCCTGGAATGG - Intronic
1189430992 X:40947220-40947242 TCAGGATACTGGCCATGGAGGGG + Intergenic
1190429759 X:50367812-50367834 TTCTGAGCCAGGCCATGGAAAGG - Exonic
1190780792 X:53592945-53592967 GCAGGAGCCAGGAGGTGGAGGGG - Intronic
1192135014 X:68589020-68589042 TCAGGAGCTAGGACCTGGAATGG - Intergenic
1192304482 X:69944468-69944490 CCAGGAGCCAGGGCCTGGAATGG + Intronic
1192875289 X:75223133-75223155 GCAGGAGCTAGGGCATGGAATGG + Intergenic
1193169019 X:78315119-78315141 TCAGGAGCTAGGGCCTGGAAAGG - Intronic
1195199309 X:102532643-102532665 CCAGGAGCCAGGGCCTGGAATGG - Intergenic
1195290086 X:103423983-103424005 TCAGGAGCTAGGGCCTGGAATGG + Intergenic
1195378489 X:104250283-104250305 ACAGGAGCCAGGCCAGTGTGAGG + Exonic
1196096796 X:111808945-111808967 TCAAGAGCCAGGGCCTGGAATGG + Intronic
1196215822 X:113050554-113050576 TCTGGAGCTAGGCCCTGGAAAGG - Intergenic
1197979409 X:132199660-132199682 TCAGGAGCCAATTCCTGGAGGGG + Intergenic
1198681579 X:139188457-139188479 TTAGGAGCCAATACATGGAGTGG + Intronic
1200211825 X:154350082-154350104 TGGGGAGCCTGGGCATGGAGGGG - Exonic
1201185627 Y:11399756-11399778 TCAGGAGGTAGCACATGGAGTGG - Intergenic
1202252616 Y:22888876-22888898 TCTGGAGCCAGGACATGTATAGG - Intergenic
1202405605 Y:24522625-24522647 TCTGGAGCCAGGACATGTATAGG - Intergenic
1202465175 Y:25147457-25147479 TCTGGAGCCAGGACATGTATAGG + Intergenic