ID: 1070605962

View in Genome Browser
Species Human (GRCh38)
Location 10:77898720-77898742
Sequence TCAGGAGCCAGGCCATGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605962_1070605978 27 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA No data
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605962_1070605969 0 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA No data
Right 1070605969 10:77898743-77898765 CAGGCCTGTGCATGCCTGAGAGG No data
1070605962_1070605973 10 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA No data
Right 1070605973 10:77898753-77898775 CATGCCTGAGAGGGCCAGGCAGG No data
1070605962_1070605976 18 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA No data
Right 1070605976 10:77898761-77898783 AGAGGGCCAGGCAGGCGGTAAGG No data
1070605962_1070605970 1 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA No data
Right 1070605970 10:77898744-77898766 AGGCCTGTGCATGCCTGAGAGGG No data
1070605962_1070605972 6 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA No data
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605962_1070605974 13 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605962 Original CRISPR TCAGGAGCCAGGCCATGGAG GGG (reversed) Intronic