ID: 1070605963

View in Genome Browser
Species Human (GRCh38)
Location 10:77898721-77898743
Sequence GTCAGGAGCCAGGCCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 1, 2: 7, 3: 51, 4: 440}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605963_1070605976 17 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC 0: 1
1: 1
2: 7
3: 51
4: 440
Right 1070605976 10:77898761-77898783 AGAGGGCCAGGCAGGCGGTAAGG No data
1070605963_1070605972 5 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC 0: 1
1: 1
2: 7
3: 51
4: 440
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605963_1070605978 26 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC 0: 1
1: 1
2: 7
3: 51
4: 440
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605963_1070605970 0 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC 0: 1
1: 1
2: 7
3: 51
4: 440
Right 1070605970 10:77898744-77898766 AGGCCTGTGCATGCCTGAGAGGG No data
1070605963_1070605969 -1 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC 0: 1
1: 1
2: 7
3: 51
4: 440
Right 1070605969 10:77898743-77898765 CAGGCCTGTGCATGCCTGAGAGG No data
1070605963_1070605973 9 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC 0: 1
1: 1
2: 7
3: 51
4: 440
Right 1070605973 10:77898753-77898775 CATGCCTGAGAGGGCCAGGCAGG No data
1070605963_1070605974 12 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC 0: 1
1: 1
2: 7
3: 51
4: 440
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605963 Original CRISPR GTCAGGAGCCAGGCCATGGA GGG (reversed) Intronic
900494778 1:2971489-2971511 GGGAGGAGGCAGGGCATGGATGG - Intergenic
900808619 1:4784484-4784506 GTCATCAGCCTGGCCATTGAGGG - Exonic
900997376 1:6129884-6129906 CTCAGGACCAAGGCCGTGGAGGG - Intronic
901064299 1:6487468-6487490 GGCGGGAGCCCGGCCATGGTGGG - Intronic
901125271 1:6924507-6924529 GGGAGAAGCCAGGCCAGGGAGGG - Intronic
901167394 1:7230137-7230159 GCCAGGAGCCAGGCCAGGCTGGG - Intronic
901819334 1:11816681-11816703 GTGAGGAGGCAGGGCCTGGAGGG + Intronic
902399661 1:16151004-16151026 TTCAGGAGTCAGACCATGGCAGG + Intronic
903845632 1:26278412-26278434 ATCTGGAGCCAGGCCAGGCAGGG + Exonic
903994367 1:27296629-27296651 CTCAAGAGCCAAGCCATGGAAGG - Intronic
904606444 1:31700415-31700437 GTCAGGAGCTAGGCCAGCAAGGG + Intronic
904832853 1:33316508-33316530 ATCTGGAGCCTGGCCATGGTGGG + Intronic
905443124 1:38006923-38006945 GTGAGCATCCAGCCCATGGATGG + Intergenic
906002865 1:42442105-42442127 GGCAGGGGGCAGGTCATGGAGGG + Intronic
906164466 1:43675632-43675654 GTCAAGAGCCAGAACCTGGAGGG + Intronic
906225598 1:44118993-44119015 GTCAGGTGCCAGCCCCTGGCAGG + Intronic
906251121 1:44311767-44311789 CTCAGGAGCCAGGTCCTGGCTGG + Intronic
906588524 1:47001831-47001853 GTGAGGCAACAGGCCATGGAGGG - Intergenic
906790941 1:48658447-48658469 GTCTGGTGCCAGGTCAAGGAAGG - Intronic
906813322 1:48851421-48851443 GGCAGGGGCCAGAGCATGGAAGG + Intronic
907067003 1:51494081-51494103 GTAAGAAGCCAGGCTGTGGATGG - Intronic
907083168 1:51643565-51643587 GGCTGGAGCCAGGCCAAGCAGGG + Intronic
907377743 1:54057775-54057797 GGCAGGCGCCAGGTCATGGAAGG - Intronic
907378276 1:54062847-54062869 GTCAGGAGCCAAGTCATGGAAGG + Intronic
908342206 1:63193142-63193164 GGCAGGAGCCAGGTCACAGAGGG + Intergenic
908488763 1:64621796-64621818 GGAAGGAGCCAGGTCATGCAGGG + Intronic
909116334 1:71541819-71541841 GCCAGGAGCAAAGCCATGAAGGG + Intronic
909449933 1:75786383-75786405 GTTAGGACACAGGCCTTGGAAGG + Intronic
910556828 1:88543762-88543784 GGCAGGGACCAGGTCATGGAAGG - Intergenic
910902322 1:92134363-92134385 GCCAGGGGCCAGATCATGGAGGG - Intronic
912472230 1:109913598-109913620 GGCAGGTGCCAGGCAAGGGATGG + Intronic
912487747 1:110042361-110042383 GTTAGCAGCCAGGCCATGCCAGG + Intronic
913217253 1:116630983-116631005 GACAGGGGCCAGGCCAGGGCAGG + Intronic
913229786 1:116732179-116732201 GGGAGCAGCCAGGCCATGCAGGG - Intergenic
914442494 1:147719641-147719663 GTCAGGGTCCAGCCCATGCAAGG - Intergenic
915634410 1:157176324-157176346 GTCAGGACTCAGGCTGTGGAAGG - Intergenic
917179502 1:172279995-172280017 GCCAGAAGCCAGACAATGGAGGG - Intronic
917729813 1:177863442-177863464 GTCAGGGCCCAGGTCAAGGAAGG + Intergenic
919976373 1:202615629-202615651 GCCAGGGGCCAGGCCAGGCAGGG - Intronic
920257793 1:204667897-204667919 GGCAGAAGCCACGCCAGGGAGGG + Intronic
920692866 1:208159974-208159996 GGAGGGAGCCAGGCCATGGATGG + Intronic
920874645 1:209822775-209822797 GTGAGGAGCCAGTCCATGAAAGG - Intergenic
921164468 1:212496608-212496630 GTCTGGAGCCAGGTGAGGGAGGG - Intergenic
921937185 1:220806339-220806361 GTCAGGACCAAAGCCAAGGAAGG - Intronic
923237084 1:232044922-232044944 GGCAGGGGCCAGGCAGTGGAAGG - Intergenic
923517869 1:234712775-234712797 AGCAGGAGCCCTGCCATGGATGG - Intergenic
924384987 1:243492004-243492026 CTCAGGACCCAGGACAGGGAGGG - Intronic
1062761391 10:23918-23940 GTCATCTGCAAGGCCATGGATGG + Intergenic
1062909005 10:1200016-1200038 GTCATGAGCCACCGCATGGAGGG - Exonic
1063096116 10:2910525-2910547 CGCAGGAGCCAGGCCTTGGCTGG - Intergenic
1063152737 10:3351751-3351773 GACAGGAGCAAAGACATGGAGGG + Intergenic
1064373268 10:14772727-14772749 GGCAGGAGCAAAGCCATGGGTGG - Intronic
1064612148 10:17114731-17114753 ATCAGGACGCAGGGCATGGAGGG + Intronic
1066661392 10:37740792-37740814 GGCTGGAGCCAGTCCATGGTTGG + Intergenic
1067083510 10:43226514-43226536 GTCAGGTGGGAGCCCATGGATGG - Intronic
1068444136 10:57098270-57098292 GCCAAGAGCCAGGGCATGTAGGG - Intergenic
1068830066 10:61483740-61483762 GGCAGGAGCCAGTCCCTGCAGGG + Intergenic
1069225945 10:65944331-65944353 GCCAGGTGCAATGCCATGGATGG - Intronic
1070605963 10:77898721-77898743 GTCAGGAGCCAGGCCATGGAGGG - Intronic
1070777288 10:79117118-79117140 GTGAGGCTGCAGGCCATGGAGGG - Intronic
1070833919 10:79436283-79436305 ATCTGGAGCCAGGCCCTGGAGGG - Intronic
1070951139 10:80431848-80431870 GGCAGGAGCCAGGCCATATTTGG + Intronic
1071667615 10:87576238-87576260 GACAGGAGTCTGGCCAGGGATGG + Intergenic
1071913241 10:90259711-90259733 GGCAGGAGCCAGTTCATAGAAGG + Intergenic
1072084858 10:92068730-92068752 GTCAGAAGTCAGGACGTGGAAGG + Intronic
1073667551 10:105550621-105550643 GTCAGCAGCCAGGCTAGGGGAGG + Intergenic
1074766267 10:116702263-116702285 GCCAGGAGCCAGGACCTGGTTGG - Intronic
1075719486 10:124576516-124576538 ATCTGGGGGCAGGCCATGGAGGG - Intronic
1076196819 10:128524645-128524667 GTCAGGAGTCAGGGCACGTAGGG + Intergenic
1076554960 10:131315254-131315276 TTCAGGAGCAAGGTCTTGGATGG + Intergenic
1076569886 10:131425731-131425753 GTGAGGAGCCGGGCAAAGGACGG - Intergenic
1076814830 10:132909574-132909596 GCCAGGAGCCAGGCCCTAGTGGG - Intronic
1077441065 11:2569505-2569527 CTCAGAAGCCGGGCCCTGGAGGG - Intronic
1078693331 11:13603845-13603867 CACAGGAGCCAGGCCAGGGATGG + Intergenic
1079110261 11:17601464-17601486 GGCAGGAGCCAGGGCGTGGGGGG + Intronic
1079244989 11:18745350-18745372 GTCTTGATCCAGGCCATGGGAGG - Intronic
1080230589 11:30015158-30015180 GTTAGGAGTCAGGCAAAGGAAGG - Intronic
1080574735 11:33587884-33587906 CATAGGAGCCAGGCCATGTACGG + Intronic
1083489255 11:63003120-63003142 GGCAGGGGCCAGAGCATGGAGGG - Intronic
1083778399 11:64905909-64905931 GGCAGGGGCCAGGACAGGGAGGG - Intronic
1083782908 11:64927150-64927172 CACCTGAGCCAGGCCATGGATGG - Intronic
1084040398 11:66539392-66539414 GGCAGGGGCAAGGCCAAGGAAGG + Exonic
1084344876 11:68540085-68540107 CTCTGGAGACAGGCCATGCAAGG + Intronic
1084444188 11:69193945-69193967 GGCTGGAGTGAGGCCATGGAAGG + Intergenic
1084531550 11:69730701-69730723 GGCAGGAGCCAGGACAGAGAGGG + Intergenic
1084573276 11:69972857-69972879 GATAGGGGCCAGGCCAGGGAGGG - Intergenic
1085298804 11:75446319-75446341 GTCCTGAGCCTGGCCAGGGAGGG - Intronic
1085471018 11:76757934-76757956 GGCAGGGGCCAGGTCATGAAGGG + Intergenic
1088179104 11:107088945-107088967 GTCACGAGCCACGAGATGGAAGG + Intergenic
1088917889 11:114240915-114240937 GGCAAGGGCCAGGCCATGCAGGG - Intronic
1089168772 11:116498346-116498368 ATGAGGAGCCAGGCCATGCTGGG - Intergenic
1089399877 11:118158185-118158207 GCCAAGGGCCAGGCCATGTAGGG + Intergenic
1089644886 11:119872392-119872414 GGAAGGAGCCAGGCCATGGAGGG - Intergenic
1090226660 11:125075947-125075969 GCCAGGAGCCAGGACATGCATGG - Intronic
1091411239 12:240902-240924 GACAGGAGTCAGGTCATGAAGGG + Intronic
1091708864 12:2722928-2722950 GGCAGGAGCCAGTCCATGAGTGG - Intergenic
1091868816 12:3869443-3869465 GGTAGGAACCAGGCCATGCATGG - Intronic
1092236972 12:6816404-6816426 GTGAGGGGCCAGGCCAGGGAGGG + Intronic
1092407320 12:8230117-8230139 CTCAGGAGCCAGCTCCTGGATGG + Intergenic
1093195041 12:16120815-16120837 GTGGGGAGCCAGGCCCGGGAAGG - Intergenic
1094531526 12:31279692-31279714 GTCAGCAGCCAGGCCATGCAGGG + Intergenic
1094719537 12:33049251-33049273 AGCAGGAGTCAGACCATGGATGG + Intergenic
1095380136 12:41581172-41581194 GGCAGAAGCCAGGTCATGAAGGG + Intergenic
1096375047 12:51102160-51102182 GCTAGGAGCCAGGTCATGAAGGG - Intronic
1096521392 12:52186689-52186711 GGCAGAAGCCAGCCCATGAAGGG - Intronic
1096954812 12:55515745-55515767 TCCAGGAGCCAGGGCCTGGAAGG - Intergenic
1097322983 12:58246183-58246205 TTCAAGAGCCAGGGCATGTAGGG + Intergenic
1099039651 12:77636173-77636195 GTCAGGAAACAGGCCAGGCACGG + Intergenic
1099940690 12:89184372-89184394 GACAGGAGCCTAGCCACGGAAGG + Intergenic
1101099749 12:101380085-101380107 GTCAGGGTCCAGGCCAGGCATGG + Intronic
1101460763 12:104890946-104890968 GCCTGGAGACTGGCCATGGAGGG - Intronic
1101741954 12:107507611-107507633 GGCAGGGGCCAGATCATGGAGGG - Intronic
1101770909 12:107750050-107750072 GCAACTAGCCAGGCCATGGAAGG - Intronic
1101837389 12:108304963-108304985 GACAGGAGCCAGGCCAAACATGG - Intronic
1102043548 12:109815905-109815927 GCCAGGAGCCAGGGCAAGGGAGG + Intronic
1102522411 12:113486799-113486821 TTCAGGAGCCAGGTCGTGGGTGG - Intergenic
1102554647 12:113719036-113719058 GACAGGAGCTGGGCCCTGGAGGG - Intergenic
1104463453 12:128972290-128972312 AGCTGGAGCCAGGCCATGGAAGG - Intronic
1104716784 12:131020791-131020813 CTCAGGGGCCAGGCCCGGGATGG + Intronic
1104776389 12:131392472-131392494 CTCAGGTGCCAGGGCATGGGGGG + Intergenic
1104842411 12:131831423-131831445 GGCAGAAGCCAGGACATGGAGGG - Intronic
1106376329 13:29191696-29191718 GTCATGAGCCAGGGAATGGTGGG - Intronic
1107854044 13:44597361-44597383 GAAAGGAGTCAGGCCAGGGACGG - Intergenic
1108466899 13:50725668-50725690 GTCAGGAGCGGGGGCATGGGAGG + Intronic
1108713999 13:53060974-53060996 GCCGGGAGCCAGGCCATGCTAGG - Intergenic
1110103129 13:71634516-71634538 GTCCGGGGCCAGGACATAGAGGG - Intronic
1113056319 13:106271955-106271977 TTCAAGAGTCAGGCCATGCACGG + Intergenic
1113839816 13:113352800-113352822 TTCAGGAGCCATGCAGTGGATGG - Intronic
1114650163 14:24279669-24279691 GACAGGAGCCAGGCACTGCATGG + Intergenic
1114730737 14:24990164-24990186 GTTACGAGCCAGGCCGGGGAAGG + Intronic
1116143864 14:41037892-41037914 GGCATGTGCCAGGCCATGGATGG + Intergenic
1117434906 14:55706635-55706657 GTCATAAGCCAGGCCAAGGAGGG + Intergenic
1117611158 14:57484719-57484741 GGCAGGGGCCAGGTCATGCAGGG + Intronic
1118329847 14:64806690-64806712 GTCAGGTGCCAGGCCCTGGGTGG + Intronic
1119387843 14:74269016-74269038 TTCAGGAGTCAGTCCATGCATGG + Intergenic
1119410746 14:74428678-74428700 GTCACCAGGCAGGCCATGGGAGG + Intergenic
1120759199 14:88270924-88270946 GGCAGGCGCCAGGTCCTGGAAGG - Intronic
1121797604 14:96747962-96747984 AGCAGGGGCCAGGCCAGGGAAGG + Intergenic
1121994713 14:98593126-98593148 GTGAGGAGCCGGGCCTAGGAAGG + Intergenic
1122041623 14:98991806-98991828 GTCATTAGACAGGCTATGGAAGG - Intergenic
1122189838 14:100032557-100032579 GACCGCAGCCAGACCATGGAGGG - Intronic
1122408564 14:101514421-101514443 GGCTGGAGCCTGGACATGGAGGG - Intergenic
1123410785 15:20057113-20057135 GTGAGGAGCCAGCCCATGTTTGG + Intergenic
1123441549 15:20295359-20295381 GTCAGGCGACAGGACATGGTCGG + Intergenic
1123520115 15:21063819-21063841 GTGAGGAGCCAGCCCATGTTTGG + Intergenic
1123584138 15:21742219-21742241 GTCAGGAGCAGGGGCAGGGAGGG - Intergenic
1123620788 15:22184822-22184844 GTCAGGAGCAGGGGCAGGGAGGG - Intergenic
1123934997 15:25189811-25189833 GCCAAGAGCCAGGCCACGGGGGG + Intergenic
1123939168 15:25208479-25208501 GCCATGAGCCAGGCCATGTGGGG + Intergenic
1123943810 15:25229361-25229383 GTCATGAGCCAGACCATGGGGGG + Intergenic
1123944982 15:25234646-25234668 GCCATGAGCCAGGCCATGTGGGG + Intergenic
1124341732 15:28894338-28894360 ATCAGGAGGGAGGGCATGGAGGG + Intronic
1124492020 15:30163979-30164001 GCCAGGGGCCAGGCCAGGCAGGG - Intergenic
1124751517 15:32374338-32374360 GCCAGGGGCCAGGCCAGGCAGGG + Intergenic
1124965445 15:34429629-34429651 ATCAGGAGGAAGGGCATGGAAGG - Intronic
1124982064 15:34575831-34575853 ATCAGGAGGGAGGGCATGGAAGG - Intronic
1125208463 15:37182583-37182605 GTCTGGAGACAGGCCAGGCATGG + Intergenic
1125465532 15:39947915-39947937 GGCAGGAGCCAAGCTGTGGAGGG - Intronic
1127483697 15:59400255-59400277 GTCAGGAGTCAGCCCAAGCATGG + Intronic
1127561170 15:60137839-60137861 ATCAGGGGCCAAGCCATGGAGGG - Intergenic
1127917244 15:63464844-63464866 GGGAGGAGGCAGGCCATGGGTGG + Intergenic
1128092280 15:64927051-64927073 GTGAGGAGCCAGAGCCTGGAAGG - Intronic
1128328209 15:66738818-66738840 ATCTGGAGCAAGGTCATGGATGG + Intronic
1128937331 15:71757962-71757984 GTCAGCAGCCTGCCCCTGGAGGG + Exonic
1129540334 15:76342813-76342835 GGCAGGCGCCAGGCCAAGGCTGG - Intergenic
1129793756 15:78360719-78360741 GTCTGGAGCCCAGCCTTGGATGG + Intergenic
1130375387 15:83324389-83324411 CTCAGAAACCAGGCCATGGAGGG + Intergenic
1130397062 15:83511949-83511971 AAAAGGAGCCAGGCCTTGGATGG + Intronic
1130665598 15:85866780-85866802 GACAGCAGCCAGACCATGCAGGG - Intergenic
1130929868 15:88416441-88416463 ATCTGGAACCAAGCCATGGAAGG - Intergenic
1131053280 15:89361824-89361846 GTCGGGAGCCAGCCCAGGGGAGG + Intergenic
1132437087 15:101816295-101816317 GTCATGAGCCAAGCAAGGGATGG + Intronic
1133080574 16:3315845-3315867 CATAGGAGCCAGACCATGGAGGG - Intronic
1133347995 16:5083227-5083249 CTCAGGAGCCGGCCCCTGGATGG + Intronic
1133741992 16:8658832-8658854 GGCAGGGGCCAGGCCTTGGAGGG - Intergenic
1134036153 16:11032821-11032843 GGCAGGGGCCAGGTCATGAAGGG + Intronic
1134629011 16:15743546-15743568 GTTAGGAGGCAGCCCAGGGAAGG - Intronic
1135199434 16:20424199-20424221 GTCAGGAACCAGATTATGGAAGG - Intronic
1136073668 16:27804202-27804224 GGCAGGAGGCAGGACAGGGACGG - Intronic
1136080476 16:27849269-27849291 GGCAGGAGCAGGGCCATGCAGGG + Intronic
1137455445 16:48614377-48614399 GTCAAGATCCAGCCCCTGGATGG - Intronic
1137694208 16:50450277-50450299 GGCAGGCGCCAGGCCAAGGGGGG - Intergenic
1139589294 16:67924566-67924588 GCCAGGAGCCTGAACATGGATGG - Intronic
1139957072 16:70698187-70698209 GAGAGGGGCCAGGCCAAGGAGGG + Intronic
1140357850 16:74321198-74321220 TTCAGGAACCAGGGAATGGAAGG + Intergenic
1142235087 16:88918323-88918345 GACAGGGCCCAGGCCATGGTGGG - Intronic
1143124910 17:4635892-4635914 GCCAGAAGCCAGGCCATTGGGGG + Exonic
1143351414 17:6290906-6290928 GTCATGGGCCAGGCCACTGATGG - Intergenic
1143432403 17:6896608-6896630 GCCAGGAGCCAGGCCATGGGGGG - Intronic
1144287238 17:13788600-13788622 GTGAGGAGGAAGGCCATGGTTGG - Intergenic
1144377635 17:14661345-14661367 TTGAGTAGCAAGGCCATGGATGG - Intergenic
1144589940 17:16515366-16515388 GGCAGGGGCCCGGCCATGAAGGG - Intergenic
1144655260 17:17031083-17031105 CCCAGGAGCCAGGCCAAGGCAGG + Intergenic
1145064215 17:19751048-19751070 GCCAGGAGCCAGGCCAGGCAGGG - Intergenic
1145159139 17:20562845-20562867 CCCAGGAGCCAGGCCAGGGCAGG - Intergenic
1145218533 17:21070064-21070086 GTCAGGACCAAGAACATGGACGG + Intergenic
1146902969 17:36600234-36600256 GGCAGGAGGCAAGCCATGAAGGG - Exonic
1147899546 17:43775039-43775061 GGCAGGGGCCAGAGCATGGAGGG - Intronic
1148697793 17:49571433-49571455 GGCAGGGGCCAGACCATGCAGGG - Intergenic
1148765554 17:50036607-50036629 GTCCTGAGCCAGGGCAGGGAGGG - Intergenic
1148842875 17:50510048-50510070 GTCAGGGGCCAGACCATGAAAGG + Intronic
1148870550 17:50656751-50656773 GCCATGGACCAGGCCATGGAAGG - Exonic
1149029222 17:52065014-52065036 GTCAGGGGCCAGCTCATAGAGGG - Intronic
1149433194 17:56610968-56610990 GTCAAGGGCCATGCAATGGAGGG + Intergenic
1150302650 17:64059405-64059427 TTCAGCAGCCCTGCCATGGAGGG - Intronic
1150334987 17:64324353-64324375 GGCAGGAGCCAGGAGAGGGAGGG - Intronic
1151549385 17:74813253-74813275 GTCAGGAGGCAGGGCTGGGAGGG + Intronic
1151957883 17:77389528-77389550 GGCAGGAGCGAGGCCCTGGGAGG - Intronic
1151975387 17:77481208-77481230 GCCAGGAGCAGGGCCATCGAAGG + Intronic
1152006545 17:77685769-77685791 GCCATGAGCATGGCCATGGAAGG + Intergenic
1152222745 17:79077974-79077996 GTCAGGAGACGGGCATTGGAGGG + Intronic
1152432648 17:80257950-80257972 GCCAGGAGCGAGGCCTGGGACGG + Intergenic
1152493114 17:80651167-80651189 GGCAGGTGCCAGGCGAGGGATGG + Intronic
1152717259 17:81906067-81906089 GCCAGGAGCCAGCCCAAGGATGG - Intronic
1152821529 17:82440060-82440082 CTCAGGCGCCCGGCCCTGGAAGG + Intronic
1152929422 17:83102259-83102281 GACAGGCACCAGGCCATGGTGGG - Intergenic
1152954298 18:24248-24270 GTCATCTGCAAGGCCATGGATGG + Intergenic
1154415077 18:14172008-14172030 GTCAGGACCAGGGCCATGGCAGG + Intergenic
1154446228 18:14437894-14437916 GGACGGACCCAGGCCATGGAGGG - Intergenic
1155442933 18:25880967-25880989 GCCAGGAGCCAGATCATGTAGGG + Intergenic
1156825486 18:41425888-41425910 GTTAGGACACAGTCCATGGATGG + Intergenic
1156916496 18:42468672-42468694 GTCATTAGAGAGGCCATGGAAGG - Intergenic
1157397469 18:47354910-47354932 GGCAGGAGCCAGGTAATTGAGGG + Intergenic
1157476730 18:48028688-48028710 GTCAGGAACCAGGCTCTGGAAGG - Exonic
1160815046 19:1031282-1031304 GGCATGAGCCAGGCCATGCCCGG - Intronic
1161373077 19:3924426-3924448 GGCAGGAGCCGGGCCCTGAAGGG + Intronic
1161974924 19:7603079-7603101 GAAAGGAGCCAGGACAGGGAGGG + Intronic
1162765724 19:12918349-12918371 GTCAGGACGGAGGCCAAGGAGGG + Intronic
1163251273 19:16127720-16127742 GTCTGGAGCGGGGCCATGGTAGG - Intronic
1163344795 19:16733825-16733847 GTCAGGAGCCAGCCTCTGGAAGG - Intronic
1163369040 19:16891896-16891918 GCCAGGAGACAGGCCTGGGACGG + Exonic
1164596320 19:29532799-29532821 GTTGGAAGCCAGGCTATGGAGGG + Intronic
1166127643 19:40725293-40725315 GTCAGGGCCAAGGCCAGGGAAGG - Intronic
1166412633 19:42566463-42566485 GTGAGGTGCCAGGACAGGGACGG + Intergenic
1166755085 19:45185698-45185720 GTCAAGAGCCAGGCCACACAGGG + Intronic
1166919901 19:46222082-46222104 ATCAGGACCAAGGCCAAGGACGG + Intergenic
1167357158 19:49011094-49011116 GTGAGGACCCAGGACATGGCCGG + Intronic
1167645838 19:50704322-50704344 GCAAGGAGACAGGCCGTGGAGGG - Intronic
925844131 2:8020425-8020447 GGGAGGGGCCAGGCCATGGGGGG + Intergenic
925914543 2:8595476-8595498 GTCAGGAGCCCGGAGGTGGACGG - Intergenic
926619999 2:15038971-15038993 GTCAGGAGCCAGAGCAGAGATGG - Intergenic
927283609 2:21334000-21334022 GTAAGGGGCCTGGGCATGGAAGG + Intergenic
927497657 2:23561650-23561672 GTGAGGCGGCAGGGCATGGATGG - Intronic
928328497 2:30338820-30338842 GACAGGAGTGAGGTCATGGAAGG + Intergenic
928435108 2:31249770-31249792 GCCAGGATCAGGGCCATGGAAGG - Intronic
930034696 2:47078157-47078179 GACAGGAGCCCCTCCATGGATGG - Intronic
930060474 2:47284092-47284114 GTCAGAAACCAGGCCATAGGGGG + Intergenic
930273644 2:49285616-49285638 TCCAGGAGCCTAGCCATGGAAGG + Intergenic
931105441 2:59050136-59050158 GTCAGGGGCCAGGGAGTGGAGGG - Intergenic
931543913 2:63359608-63359630 GTCTGGTGCTAGGCCATGTATGG - Intronic
931694343 2:64860386-64860408 GGCAGGTGGCAGGCCCTGGAGGG - Intergenic
931795348 2:65703050-65703072 GTCAGGATCCAGGACTTGGAAGG - Intergenic
932894571 2:75626475-75626497 CTGAGGAGACAGGCCATGCATGG - Intergenic
934562283 2:95319604-95319626 ATAAGGAGCCAGGCCAAGGGCGG - Intronic
934974147 2:98788554-98788576 GTCTGAAGCCAGGCCATGAAAGG - Intergenic
935185560 2:100729161-100729183 GTCAGGAACAAAGCCAGGGAAGG + Intergenic
935363443 2:102267074-102267096 CTCAGGAGGCATGCCATGGCTGG - Intergenic
936239338 2:110773561-110773583 GTCAGGAGCCAGTCCTGGGATGG - Intronic
936965993 2:118128071-118128093 GGCAGGAGCCAGGTCCTGAAGGG - Intergenic
937043683 2:118839371-118839393 GTTAGGGGGAAGGCCATGGATGG - Intergenic
937332018 2:121037620-121037642 GGCAGGGGCCAGGCCATGCAGGG - Intergenic
937335222 2:121058430-121058452 GGCAGGAGGCAGCCCCTGGAGGG + Intergenic
937669245 2:124521108-124521130 GTCAGGAGCCATGTCATTGGAGG - Intronic
937883667 2:126886236-126886258 CCCAGGAGCCAGGCCATGTCCGG + Intergenic
940058681 2:149540684-149540706 GGCAAGAGCCATACCATGGAGGG - Intergenic
940631848 2:156250265-156250287 GTCAGGAGCCAAGAAATGGATGG - Intergenic
942903419 2:181151472-181151494 CTGAGGAGTCAGGTCATGGAGGG + Intergenic
943082077 2:183267516-183267538 CTCAAGAGCCAGGGCATGCAGGG - Intergenic
943412238 2:187559022-187559044 GTCATGAGACAGGCTACGGAAGG + Intronic
946410801 2:219514252-219514274 GTCAGGAGCCAGGCCAGGGGAGG - Intronic
946957703 2:224949999-224950021 GTCAGGAGCTAGTTCATGGAAGG + Intronic
947134474 2:226963628-226963650 GTGAGAAGCAAGGGCATGGAAGG - Intronic
947637638 2:231688185-231688207 GTTTGGTGCCAGGCCATGGTGGG + Intergenic
947758774 2:232588239-232588261 GGCTGGAGCCAGGGCATGGTGGG - Intergenic
948015458 2:234686625-234686647 GCCAGGAGCCAGGGAATGTAAGG + Intergenic
948687029 2:239676085-239676107 GTGAGCAGCCAGCCCATGGGCGG - Intergenic
948790132 2:240372636-240372658 GAGGGGGGCCAGGCCATGGAGGG + Intergenic
948850722 2:240704113-240704135 GTCTGGGGCCAAGGCATGGAAGG - Intergenic
1168739770 20:177743-177765 GTCATTAGACAGGCTATGGAAGG - Intergenic
1168879420 20:1194065-1194087 GTCATGTTCCAGGCCCTGGAAGG + Intergenic
1168898762 20:1342251-1342273 GTCAAAAGCCAGGCCATGACTGG - Intronic
1170572984 20:17642784-17642806 CTCAGGAGCCAGGCCATGGGTGG + Intronic
1171006555 20:21471505-21471527 GGCAGGGGTCAGGCCTTGGAGGG + Intergenic
1171163842 20:22953365-22953387 GTCAGAAGTGAGGACATGGATGG + Intergenic
1171337861 20:24402454-24402476 CACAGGAACCAAGCCATGGATGG + Intergenic
1171448877 20:25222635-25222657 CTCAGGAGCCAGGGCATTGTTGG - Intronic
1172121657 20:32602368-32602390 GTCCTGAGCCTGGCCCTGGAGGG + Intronic
1173325122 20:42026229-42026251 GACAGGAGCCAGACCATGCTGGG + Intergenic
1174117578 20:48237873-48237895 ATGAGGGGTCAGGCCATGGAGGG - Intergenic
1174163934 20:48571274-48571296 ATGAGGGGTCAGGCCATGGAGGG + Intergenic
1174295077 20:49540033-49540055 GTCAGGTGCCAGGTGAGGGAGGG + Intronic
1174339641 20:49887773-49887795 GTCAGGGGCAGGGCCATGGAAGG - Intronic
1174777607 20:53359779-53359801 GGCAGGAGTCAGACCGTGGAGGG + Intronic
1174869218 20:54167988-54168010 GCCAGCAGCCAGCTCATGGAGGG - Intronic
1175452702 20:59083674-59083696 GGCAGGAGAAAGGGCATGGAGGG + Intergenic
1175523782 20:59619628-59619650 GTCAGAAGTCAGGACATGGCAGG - Intronic
1175550478 20:59814138-59814160 GTCAGGAGCGAGGGCATGTCTGG + Intronic
1175653551 20:60749691-60749713 GGCTGGAGCAAGGCCATGCAAGG + Intergenic
1175733519 20:61370204-61370226 GGGAGGAGCCAGGTCAAGGAGGG + Intronic
1176449754 21:6851952-6851974 GGATGGACCCAGGCCATGGAGGG + Intergenic
1176827926 21:13716976-13716998 GGATGGACCCAGGCCATGGAGGG + Intergenic
1176866209 21:14056406-14056428 GTCAGGACCAGGGCCATGGCAGG + Intergenic
1179157587 21:38863481-38863503 GACAGCAGCTAGGCCCTGGATGG - Intergenic
1179564663 21:42239771-42239793 GCCAGGGGCCAGGCCCCGGACGG - Intronic
1179925811 21:44533540-44533562 GTCAGGAGCCATGGGGTGGAGGG - Intronic
1179934587 21:44593961-44593983 GGCTGGAGCCAGTCCATGGTTGG - Intronic
1180818613 22:18809383-18809405 GACAGGGGCCAGGCCAGGGCAGG + Intergenic
1180980655 22:19876630-19876652 TGCAGGAGCCAGGCCTTGGTGGG + Intronic
1181204836 22:21243838-21243860 GACAGGGGCCAGGCCAGGGCAGG + Intergenic
1181256551 22:21566688-21566710 GGCAGGGGACAGACCATGGAGGG - Intronic
1181457439 22:23067665-23067687 GTCAGGAACCAGAGAATGGAGGG - Intronic
1181509927 22:23384636-23384658 GTCGGGAACCAGGCCAGGGAGGG - Intergenic
1181917170 22:26290720-26290742 GGCAGGGGCCAGGCCCTGGAGGG - Intronic
1182049342 22:27300963-27300985 GTCTGGAGCCAGGCTAGGGCAGG - Intergenic
1182520215 22:30880879-30880901 GTCAGGGGCCATGCCATGTGAGG - Intronic
1182668304 22:31974835-31974857 AGAAGGAGCCAGGCAATGGAAGG + Intergenic
1182857512 22:33531068-33531090 GTCAGGTGTCAGGTTATGGATGG - Intronic
1183310428 22:37106739-37106761 GACAGCAGCCTGGCCATGGAGGG - Intronic
1184490909 22:44808392-44808414 CTCTGGAGCCAGCCCAGGGAAGG - Exonic
1184580396 22:45413143-45413165 GTCGGGAGCCAGGAGGTGGAGGG + Intronic
1184762136 22:46550672-46550694 GTCGGGAGCTGGGCCATGGAGGG + Intergenic
1184768763 22:46586252-46586274 GGGAGGAGCCAGGGCAAGGAAGG - Intronic
1185325740 22:50225098-50225120 GGCTGGTTCCAGGCCATGGACGG + Intronic
1185330417 22:50249749-50249771 TCCAGGAGCCCGGCCAGGGATGG + Intronic
1185375710 22:50481842-50481864 GTCGGGATCCGGGCCATGGCGGG - Exonic
1203222089 22_KI270731v1_random:51577-51599 GACAGGGGCCAGGCCAGGGCAGG - Intergenic
1203268742 22_KI270734v1_random:35236-35258 GACAGGGGCCAGGCCAGGGCAGG + Intergenic
949370450 3:3328925-3328947 AACAGAAGCCAGGCCATGAAGGG + Intergenic
949505548 3:4724436-4724458 GTCAGGTGGCAGGCCAGGGCTGG - Intronic
950466000 3:13153985-13154007 ATCATGAGGCAGGGCATGGAGGG + Intergenic
950497801 3:13344684-13344706 GGCAGGAGCCAGGCCATACCAGG - Intronic
950674344 3:14545513-14545535 GCCAGGGGCCTGGCCACGGATGG + Intergenic
950880113 3:16316660-16316682 GTCAGGAACCTGGCCCTGGGAGG + Exonic
951218339 3:20044514-20044536 AGCAGTAGCCAGGCCATGCAGGG - Intronic
952012195 3:28912389-28912411 GTCAGAAGCCAGAACATTGAAGG + Intergenic
953912919 3:46901875-46901897 CTGAGGAGCCAGGGCATGGCAGG - Intronic
954142868 3:48619127-48619149 GTAAGAAGCCAGACCATGTAGGG + Intergenic
954448880 3:50561121-50561143 GTCAGGAGGCAGGGCCTGGAGGG - Intronic
954780062 3:53052126-53052148 TGCAGGAGCCAAGACATGGAGGG - Intronic
955128971 3:56144636-56144658 GTCAGGAGGAAGGGCATGGCAGG + Intronic
957011715 3:75013441-75013463 AGCAGGAGCCAGGCCATAGCAGG - Intergenic
957300188 3:78381719-78381741 GTCAAGATCAAGGCAATGGAAGG - Intergenic
957838931 3:85640591-85640613 GTCAGGAGCCAAGACCTGGTTGG + Intronic
960406162 3:117262418-117262440 GGCTGGAGCCAGGTCATGGTGGG - Intergenic
961484723 3:127208739-127208761 CTCAGGAGCCAGGCCCGGGCTGG + Intergenic
961866322 3:129955980-129956002 GTCAGGAGCCAGGCGATCAATGG + Intergenic
961885984 3:130096721-130096743 CTCAGGAGCCGGCCCCTGGATGG + Intronic
962407186 3:135110411-135110433 GTCAGGAGGGAGGACAGGGATGG - Intronic
963864140 3:150342057-150342079 GTTTGGAGCCAGGCCCTGGCAGG - Intergenic
964927313 3:161975127-161975149 CTCAGGAGGGAGGCCAAGGAGGG - Intergenic
966279825 3:178213604-178213626 GTCATTAGACAGGCTATGGAAGG - Intergenic
967117239 3:186352950-186352972 GACAGGAGCTGGGCCATGGAGGG - Intronic
967389773 3:188944314-188944336 GAAGGGAGCCAGGCCATAGAAGG + Intergenic
967540937 3:190667021-190667043 GGTAGCAGCCAGGCCAGGGACGG - Intergenic
967669893 3:192220269-192220291 AGGAGGAGCCAGGTCATGGAGGG - Intronic
967992725 3:195143543-195143565 GCCAGGAGCCAGGGCACAGAAGG + Intronic
968454998 4:693185-693207 ATCAGCAGCCGGGCCCTGGAGGG - Intergenic
968641796 4:1718500-1718522 ATCAGGATGCAGGCGATGGAGGG + Exonic
968735000 4:2290697-2290719 GGCAGGGGCCAGGCCAGGGCTGG + Intronic
969056676 4:4406872-4406894 GGCAGGAGCCCAGCCAGGGAGGG - Intronic
969664924 4:8551945-8551967 GTCAGGTCCTAGGCCATGGTTGG - Intergenic
969816501 4:9691552-9691574 CCCAGGAGCAAGGCCATGGTCGG - Intergenic
969818795 4:9705397-9705419 CTCAGGAGCCGGCCCCTGGATGG - Intergenic
969928983 4:10611905-10611927 GTCAGGGACCAGACCATGGAGGG - Intronic
971182430 4:24341955-24341977 GCCAGGAGCCAGATCATGGAGGG + Intergenic
973282617 4:48375721-48375743 AGCTGGAGCCAGGTCATGGAAGG - Intronic
974587517 4:63898079-63898101 GACAGAAGCCAGGGCATGTAAGG - Intergenic
975620688 4:76293231-76293253 CTCAGCAGCCAAGACATGGAAGG - Intronic
976096639 4:81515351-81515373 GGCAGGAGCCAGGACACAGAGGG + Intronic
978955099 4:114602818-114602840 GGCAGGAGCAAGATCATGGAGGG + Intronic
979901843 4:126230654-126230676 GGTAGAAGCCAGGCCATGCAAGG + Intergenic
981518396 4:145634847-145634869 TTCAGGAGCTAGGGCCTGGAAGG + Intronic
982089998 4:151872244-151872266 AGCAGGAGCCAGATCATGGAAGG + Intergenic
985760613 5:1746829-1746851 GTCAGGACACAGACCAGGGAGGG + Intergenic
985998849 5:3614096-3614118 GGCAGGACCAAGGCCCTGGATGG - Intergenic
987124840 5:14802601-14802623 GTGAGGGACCAGACCATGGAGGG - Intronic
987485277 5:18518438-18518460 ATCACGAGCCAGGCCAGAGATGG + Intergenic
987516606 5:18918292-18918314 GTCACCACCCAGGCCAAGGAAGG - Intergenic
990563289 5:57004733-57004755 GGCTAGAGCCAGGTCATGGAGGG - Intergenic
990724626 5:58740128-58740150 ATCAGGAGCCAGGCCAGGCAGGG + Intronic
991327655 5:65454889-65454911 GTCAGGAGTCTGTGCATGGATGG - Intronic
991397912 5:66223785-66223807 GTGAGGAACCAGGAGATGGAAGG + Intergenic
991667820 5:69016910-69016932 TTCAGGAGACAGGCAGTGGAGGG + Intergenic
991933605 5:71780829-71780851 CCCAGGAGCCAGAGCATGGAGGG - Intergenic
991953110 5:71965938-71965960 TCCAGGAGCCAGGGGATGGAAGG - Intergenic
992947106 5:81821932-81821954 GTCTGGAGGAGGGCCATGGATGG - Intergenic
995597337 5:113762199-113762221 GTCCTGAGCCAGGCAAGGGAGGG - Intergenic
995847915 5:116513775-116513797 GTCAGAGGGCAGGGCATGGAAGG - Intronic
997038172 5:130218167-130218189 GTGAGGTGCCAGGCCATGTAGGG + Intergenic
997880625 5:137586513-137586535 AGCAGGAGCCAGCCCATGAAGGG + Intronic
1001536087 5:172498816-172498838 GCCCTGAGCCAGGCCCTGGAGGG - Intergenic
1002355927 5:178628475-178628497 GTCAGGAGCCGGGAAATGGGTGG - Intronic
1002603919 5:180370854-180370876 GGCAGGGGCCAGGCCAGAGAAGG + Intergenic
1003563953 6:7206768-7206790 GGCAGGAGCCAGGCTTGGGAAGG + Intronic
1004159898 6:13204155-13204177 AGCAGGAGCCAGCCCATGGAAGG + Intronic
1005257157 6:24015220-24015242 GTCAGGAAACAGGCCAGGCATGG - Intergenic
1005659258 6:27977835-27977857 GTCAGCTGCCAGGCAATGGAAGG + Intergenic
1006081172 6:31567766-31567788 GGCAGGGGCCAGGTCATGCAGGG - Intergenic
1006454262 6:34122974-34122996 GCCAGGAGGCAGGCCGTGGAAGG + Intronic
1006511790 6:34525590-34525612 GTCAGGAGCCAGGACTCAGAGGG - Intronic
1007067588 6:39007635-39007657 GGCAGGAGCCAGACCATGCAGGG - Intronic
1007312087 6:40954770-40954792 GCCAGGAGCCAGCTCATGAAAGG + Intergenic
1007418038 6:41703418-41703440 GGCAGGAGCCAGGCACTGGCGGG - Intronic
1007704368 6:43781820-43781842 GTCAGCCCCCAGGCCCTGGAAGG - Intronic
1008662471 6:53682099-53682121 GTCAGGTGTCAGCCCAGGGAGGG + Intergenic
1008686354 6:53930019-53930041 GTCAGGAGCGTTGCCATTGATGG + Intronic
1008713947 6:54265594-54265616 GTCATCAGCCAAGTCATGGAAGG + Intronic
1011964430 6:93136407-93136429 TTCAGGAGGCAGGGAATGGAGGG - Intergenic
1013044288 6:106469042-106469064 GGCAGGAGCCAGGCCACGCAGGG - Intergenic
1013327524 6:109062408-109062430 GTCAGCAGCCACACCATGGAGGG + Intronic
1015044127 6:128759074-128759096 GTCAGGAACCAGGTGATGTAGGG + Intergenic
1015911028 6:138167887-138167909 GGTAGGAGCCAGGCCATGTACGG - Intronic
1018608678 6:165625252-165625274 GCAAGGAGCCAGGCCAAGGCCGG + Intronic
1019285758 7:222143-222165 GTCAGGAGACAGGGCAGGGCTGG + Intronic
1019540059 7:1547359-1547381 GTCAGGGGTCTGGCCAGGGACGG - Intronic
1020319432 7:6929188-6929210 CTCAGGAGCCGGCTCATGGATGG + Intergenic
1023780038 7:43646956-43646978 GTCAGCAGCCAGGACATTTAAGG - Intronic
1023839932 7:44091077-44091099 GCCAGGAGTATGGCCATGGAGGG + Intergenic
1024279089 7:47703703-47703725 GGGAGGAGCCAGTCCCTGGATGG + Intronic
1025826620 7:65015942-65015964 GTCAAGAGACTGGACATGGAAGG + Intergenic
1025888334 7:65620919-65620941 GTCTGGAGCCAGATCATGCACGG + Intergenic
1025914176 7:65852391-65852413 GTCAAGAGACTGGACATGGAGGG + Intergenic
1026129389 7:67607501-67607523 GACAGAAGTAAGGCCATGGAGGG + Intergenic
1027372143 7:77517792-77517814 GGCAGGGGTCAGGGCATGGATGG - Intergenic
1027866047 7:83648556-83648578 GTGAGGAGCGAGGGCTTGGACGG - Exonic
1029258259 7:99284085-99284107 GCCAGGAGCCAGGCACTGTATGG + Intergenic
1029734719 7:102459268-102459290 GTGAGGAGACAGGACACGGATGG + Intronic
1032351314 7:131166466-131166488 GTGGGCAGCCAGGCCATTGAAGG - Intronic
1033012247 7:137635143-137635165 GTCATGAGCCATCCCATTGATGG + Intronic
1033037142 7:137885351-137885373 GACAGGGGCCAGGCCAGGGGCGG + Intronic
1033426808 7:141252205-141252227 GGCAGGTACCAGTCCATGGATGG + Intronic
1033529077 7:142245101-142245123 GGCAAGGGCCAGGCCAGGGAAGG + Intergenic
1034020537 7:147637080-147637102 GGGAGGAGCCAGGTCACGGAGGG + Intronic
1034072695 7:148202149-148202171 GGCAGGAGAGAGGCCATTGAAGG - Intronic
1034460745 7:151196675-151196697 GTCAGGAGCCAGGCCCTGGCTGG + Intronic
1034875905 7:154724635-154724657 GCCAGGAGCCAGCTCCTGGAGGG - Intronic
1036114789 8:5946766-5946788 GCAAGGAGCCAGGCAATGGCTGG + Intergenic
1036116988 8:5969687-5969709 TGCAGGTGCCTGGCCATGGAAGG - Intergenic
1036531285 8:9590179-9590201 GACGGGAGCCAGACCAAGGAGGG - Intronic
1036703970 8:11032752-11032774 GGCAGGAGGCAGGGCTTGGAGGG - Intronic
1037688148 8:21161295-21161317 GTCATGACCTTGGCCATGGAAGG + Intergenic
1037750946 8:21682062-21682084 GTAGTGAGCCAGACCATGGAGGG + Intergenic
1038207283 8:25478566-25478588 GTTAAGAACCAGGCCAGGGAAGG - Intronic
1038325498 8:26569733-26569755 ATCAGGAGGGAGGTCATGGAGGG + Intronic
1038440220 8:27566201-27566223 GTCAGGAGCCACCCTTTGGAGGG + Intergenic
1040543199 8:48377802-48377824 GTCAGGATCTAGGCCACGAATGG - Intergenic
1043045188 8:75314314-75314336 GGCAGGAGCCAGACCATGAAGGG - Intergenic
1043225168 8:77718271-77718293 ATCAAGAGCCAGGACATGCAAGG - Intergenic
1043405893 8:79932520-79932542 GGCAGGAGGCAGGCCATGTAAGG + Intronic
1044959317 8:97515068-97515090 GGCAGGAGTCAGACCTTGGAGGG - Intergenic
1045025841 8:98085733-98085755 CGCAGAAGCCAGGTCATGGAGGG - Intronic
1049090429 8:140510486-140510508 GTCAGGGGCCAGACCAGGGAAGG - Intergenic
1049107570 8:140623456-140623478 CTCAGGAGACAGGCCAAGGCTGG - Intronic
1049272614 8:141703922-141703944 GTCTGGAGCCTGGCCAGGGGAGG + Intergenic
1049427267 8:142543052-142543074 GCCAGGAGCCAGGATATGGTGGG - Intronic
1049698230 8:143994026-143994048 GCCAGGTCCCAGGCAATGGAGGG - Intronic
1049748940 8:144274531-144274553 TTCAGGAGCCAGGCCAGGCCCGG - Intronic
1049827826 8:144681288-144681310 GACAGGAGACAGGCCAGGCAGGG + Intergenic
1050116192 9:2265855-2265877 GTCAGAAGCCAGGCAAAGGGTGG - Intergenic
1053020547 9:34691123-34691145 GCCAGTAGCAGGGCCATGGAGGG + Exonic
1053269821 9:36742404-36742426 CTCAGGATCCATGCAATGGAAGG - Intergenic
1053310817 9:37018306-37018328 GACAGCAGCCAGGCCCTGGGTGG + Intronic
1053567769 9:39271080-39271102 GACAGGAAACAGGCGATGGAAGG - Intronic
1054129374 9:61347919-61347941 GACAGGAAACAGGCGATGGAAGG + Intergenic
1056127843 9:83554540-83554562 GTCTGGTGACAAGCCATGGAGGG + Intergenic
1056310890 9:85339848-85339870 GACAGGAGGCTGGCCCTGGATGG - Intergenic
1056756913 9:89387418-89387440 GACCGGACCCAGGCCCTGGATGG - Exonic
1057512386 9:95691626-95691648 GACAGGGGCCAGATCATGGAAGG - Intergenic
1057764049 9:97900321-97900343 GTCACGAGCTAGCCCATGGCAGG + Intergenic
1058899599 9:109430787-109430809 GAGAGGGGCCAGGTCATGGAGGG - Intronic
1059573244 9:115463009-115463031 GTCAGGAGCCAGACCATGGAAGG + Intergenic
1060721990 9:125985723-125985745 GTCAGGGGCCAGGCAGAGGAGGG - Intergenic
1060801519 9:126548504-126548526 GGCAGAAACCAGGCCTTGGATGG + Intergenic
1060836179 9:126756617-126756639 CTCAGGAGAGAGGCCAGGGATGG - Intergenic
1061275906 9:129569232-129569254 GGCCGGGGCCAGGCCAGGGAGGG + Intergenic
1061540358 9:131275069-131275091 GTCAGGAAGCAGGCCAGGAAAGG + Intronic
1061668629 9:132175282-132175304 GTCAGGAGCCAGACACAGGAAGG - Intronic
1062285961 9:135772596-135772618 CACAGGAGCCAGGCCATGACAGG + Intronic
1062326503 9:136015046-136015068 GGCAGGAGACGGGCCATGGCAGG - Intronic
1062389714 9:136329125-136329147 GGCAGGAGCCAGCCCCTGGCAGG + Intronic
1203519430 Un_GL000213v1:32565-32587 GGATGGACCCAGGCCATGGAGGG - Intergenic
1186673888 X:11795319-11795341 GTAAGGATCCAGGCCTTGGCAGG + Intergenic
1188979025 X:36709646-36709668 GATAGGACCCAGACCATGGAAGG + Intergenic
1189320738 X:40085702-40085724 GGCAGGTGCCAGGGCTTGGAAGG + Intronic
1189430991 X:40947219-40947241 ATCAGGATACTGGCCATGGAGGG + Intergenic
1190780793 X:53592946-53592968 GGCAGGAGCCAGGAGGTGGAGGG - Intronic
1190832050 X:54067602-54067624 GTCAGGTGCCAGATCATGAAGGG + Intergenic
1192314148 X:70038997-70039019 TTCAGGAGCCTGGCCAGGCAGGG + Exonic
1192357075 X:70414017-70414039 GTCAAGGGCCAGATCATGGAGGG + Intronic
1192795201 X:74420637-74420659 GCCAGGAGCCGGGCCAGGAAGGG - Intergenic
1194221598 X:91200268-91200290 GCCAGCAGGCAGGCCATTGACGG + Intergenic
1194640591 X:96399372-96399394 GGCAGAAGCCAGATCATGGACGG - Intergenic
1195682929 X:107562284-107562306 GGCAGGAGCCAGTTCATGGAGGG + Intronic
1196525025 X:116721344-116721366 GTCATTAGACAGGCTATGGAAGG + Intergenic
1198244149 X:134813196-134813218 GTCTGGAGCCAAACCGTGGATGG + Intronic
1198832833 X:140769267-140769289 GTCTGGGGCCAGATCATGGAGGG + Intergenic
1198882844 X:141299811-141299833 GTCAGGAGGTAGGACAGGGAAGG - Intergenic
1199429833 X:147746274-147746296 GTTAGGACTCAGGTCATGGAGGG - Intergenic
1199553489 X:149081199-149081221 CACAGAAGCCATGCCATGGAGGG + Intergenic
1200558111 Y:4664024-4664046 GCCAGCAGGCAGGCCATTGACGG + Intergenic