ID: 1070605963

View in Genome Browser
Species Human (GRCh38)
Location 10:77898721-77898743
Sequence GTCAGGAGCCAGGCCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605963_1070605972 5 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC No data
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605963_1070605970 0 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC No data
Right 1070605970 10:77898744-77898766 AGGCCTGTGCATGCCTGAGAGGG No data
1070605963_1070605969 -1 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC No data
Right 1070605969 10:77898743-77898765 CAGGCCTGTGCATGCCTGAGAGG No data
1070605963_1070605974 12 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605963_1070605976 17 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC No data
Right 1070605976 10:77898761-77898783 AGAGGGCCAGGCAGGCGGTAAGG No data
1070605963_1070605973 9 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC No data
Right 1070605973 10:77898753-77898775 CATGCCTGAGAGGGCCAGGCAGG No data
1070605963_1070605978 26 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC No data
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605963 Original CRISPR GTCAGGAGCCAGGCCATGGA GGG (reversed) Intronic