ID: 1070605964

View in Genome Browser
Species Human (GRCh38)
Location 10:77898722-77898744
Sequence TGTCAGGAGCCAGGCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 368}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605964_1070605978 25 Left 1070605964 10:77898722-77898744 CCTCCATGGCCTGGCTCCTGACA 0: 1
1: 0
2: 3
3: 44
4: 368
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605964_1070605969 -2 Left 1070605964 10:77898722-77898744 CCTCCATGGCCTGGCTCCTGACA 0: 1
1: 0
2: 3
3: 44
4: 368
Right 1070605969 10:77898743-77898765 CAGGCCTGTGCATGCCTGAGAGG No data
1070605964_1070605970 -1 Left 1070605964 10:77898722-77898744 CCTCCATGGCCTGGCTCCTGACA 0: 1
1: 0
2: 3
3: 44
4: 368
Right 1070605970 10:77898744-77898766 AGGCCTGTGCATGCCTGAGAGGG No data
1070605964_1070605972 4 Left 1070605964 10:77898722-77898744 CCTCCATGGCCTGGCTCCTGACA 0: 1
1: 0
2: 3
3: 44
4: 368
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605964_1070605974 11 Left 1070605964 10:77898722-77898744 CCTCCATGGCCTGGCTCCTGACA 0: 1
1: 0
2: 3
3: 44
4: 368
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605964_1070605976 16 Left 1070605964 10:77898722-77898744 CCTCCATGGCCTGGCTCCTGACA 0: 1
1: 0
2: 3
3: 44
4: 368
Right 1070605976 10:77898761-77898783 AGAGGGCCAGGCAGGCGGTAAGG No data
1070605964_1070605973 8 Left 1070605964 10:77898722-77898744 CCTCCATGGCCTGGCTCCTGACA 0: 1
1: 0
2: 3
3: 44
4: 368
Right 1070605973 10:77898753-77898775 CATGCCTGAGAGGGCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605964 Original CRISPR TGTCAGGAGCCAGGCCATGG AGG (reversed) Intronic
900333119 1:2146435-2146457 TGGGAGGTGCCCGGCCATGGTGG - Intronic
900367302 1:2316447-2316469 AGCCAGGAGCCAGGCTGTGGGGG - Intergenic
900506553 1:3032313-3032335 TCTGAGCAGCCAGGCCCTGGTGG + Intergenic
901064300 1:6487469-6487491 AGGCGGGAGCCCGGCCATGGTGG - Intronic
901167395 1:7230138-7230160 GGCCAGGAGCCAGGCCAGGCTGG - Intronic
901353948 1:8626399-8626421 TGTCAGTAGCTAGGCTATGATGG - Intronic
901735538 1:11309972-11309994 TGTCAGGAGCTGGGCCATCTTGG - Intergenic
903104531 1:21064013-21064035 TGACAGGAGGCTGGGCATGGTGG - Intronic
903403243 1:23073652-23073674 GGCCAGGAGCCAGAGCATGGGGG - Intronic
903501411 1:23802033-23802055 TCTCAGGACACAGGTCATGGAGG - Exonic
904832852 1:33316507-33316529 AATCTGGAGCCTGGCCATGGTGG + Intronic
905224088 1:36467906-36467928 TGGCGGGCTCCAGGCCATGGAGG + Exonic
906164465 1:43675631-43675653 TGTCAAGAGCCAGAACCTGGAGG + Intronic
906981164 1:50631001-50631023 GGTCAGGAGCCTGGCCAAGATGG - Intronic
907489921 1:54802159-54802181 TGGCAGGAGCCAGGCCCAGGTGG - Intergenic
908089346 1:60670027-60670049 TGGCAGGAGCCAAGACATAGTGG + Intergenic
909399785 1:75214196-75214218 TGTCAGGAGCCCTGCAGTGGTGG + Intronic
910694011 1:89993673-89993695 CGCCAAGATCCAGGCCATGGAGG - Intergenic
912902272 1:113664443-113664465 TGTGAGAAGCCAGGCATTGGTGG + Intronic
913257640 1:116968709-116968731 TGCCAGGGGCAAGGGCATGGGGG - Intronic
914254289 1:145948551-145948573 TGAGAGAAGCCAGGGCATGGGGG + Intronic
915139381 1:153757732-153757754 TGTCAGGAGCCAACCAATGATGG - Exonic
916276696 1:163001672-163001694 AGTCAGGAGCCAGGGCCTGTAGG - Intergenic
916330029 1:163604980-163605002 TGTCAGGAGATAGGCCAAAGAGG - Intergenic
916497924 1:165361878-165361900 TGCCATGAGCCCAGCCATGGAGG - Intergenic
920201288 1:204261367-204261389 GGCCTGGATCCAGGCCATGGGGG - Exonic
921164469 1:212496609-212496631 TGTCTGGAGCCAGGTGAGGGAGG - Intergenic
921221321 1:212976062-212976084 TGTCAGGAGTCAGGAGGTGGTGG + Intronic
921861223 1:220044435-220044457 TATCAGGAGGCTGGGCATGGTGG + Intronic
922589675 1:226765286-226765308 TATCATGAGACAGGACATGGGGG - Intergenic
922898734 1:229120326-229120348 TGGCAGTTGGCAGGCCATGGTGG - Intergenic
922980451 1:229821773-229821795 TATCATGTGCCAGGCCCTGGGGG - Intergenic
923342983 1:233023165-233023187 TTTCAGGAGGCAGGACAGGGTGG - Intronic
923369797 1:233298499-233298521 TTAGAGGAGCCTGGCCATGGAGG + Intergenic
924062794 1:240193690-240193712 TGTCAGGCTGCAGGCCAAGGAGG - Intronic
1062979867 10:1713098-1713120 TGTTAGGAGTCAGGCGATGGAGG + Intronic
1065193906 10:23242254-23242276 TGTCAGTAGGCCGGGCATGGTGG - Intergenic
1065339742 10:24693708-24693730 TGGCAGGAGCCAGTGAATGGGGG - Intronic
1065605446 10:27413710-27413732 TGTGGGGAGCCCGGCCAAGGCGG - Exonic
1066590877 10:36992860-36992882 TTGCAGGAGCCAGGCCATACAGG + Intergenic
1069729098 10:70599703-70599725 TGTCAGGATCCCGGGCATGTGGG - Intronic
1069781078 10:70956012-70956034 TGTCAAGAGACAGGGCAAGGAGG - Intergenic
1069902415 10:71713702-71713724 TTTCAGGCACCAGGCCAGGGGGG - Exonic
1070605964 10:77898722-77898744 TGTCAGGAGCCAGGCCATGGAGG - Intronic
1070692643 10:78539072-78539094 TGGCATAAGCCAGGACATGGAGG - Intergenic
1070777289 10:79117119-79117141 TGTGAGGCTGCAGGCCATGGAGG - Intronic
1070779520 10:79129520-79129542 AGACTGGAGCCAGGCCCTGGGGG - Intronic
1070833920 10:79436284-79436306 GATCTGGAGCCAGGCCCTGGAGG - Intronic
1070939495 10:80330882-80330904 TGTTAGGAGCCAGATCATGAAGG - Intergenic
1071985826 10:91049348-91049370 TGTCAGGAGAGAGGCCCAGGTGG - Intergenic
1072294656 10:93997528-93997550 TGTCAGGAGCCAGTCAAAGTGGG + Intronic
1072727312 10:97822433-97822455 GGTCAGAAGCCAGGCCCAGGGGG + Intergenic
1073054275 10:100689133-100689155 TCACAGGAGCCTGTCCATGGCGG + Intergenic
1073070094 10:100787802-100787824 TGTGAGGAGCGAGGAAATGGGGG + Intronic
1075797291 10:125129759-125129781 TGTGAGGACCAAGGCCCTGGAGG + Intronic
1076814831 10:132909575-132909597 GGCCAGGAGCCAGGCCCTAGTGG - Intronic
1077474081 11:2778232-2778254 TGGAAGGAGCCAGGCCAGGCTGG + Intronic
1078051392 11:7967764-7967786 TGCCTGTAGCCAGGCCAGGGTGG - Intergenic
1078642678 11:13111070-13111092 TGCCAGGAGACAGACAATGGGGG - Intergenic
1079004554 11:16782714-16782736 GGGCAGGATCCAGGCCTTGGGGG + Intronic
1079110260 11:17601463-17601485 TGGCAGGAGCCAGGGCGTGGGGG + Intronic
1079112095 11:17610694-17610716 TGTCGGGAGGCAGGCCAGAGAGG - Exonic
1081806033 11:45891029-45891051 CATCAGGAGCCAGGCCAAGGCGG - Intronic
1083616022 11:64027071-64027093 TCTTAGGTGCCAGGCCATGCCGG - Intronic
1083889395 11:65588464-65588486 AGTCAGCAGGCAGGCCATGGTGG + Intronic
1085781355 11:79412057-79412079 TGTTAGAAGTCAGGCCCTGGTGG + Intronic
1085897420 11:80656569-80656591 TTGCAGGAGCCAGGCCATATAGG - Intergenic
1086103096 11:83121986-83122008 TGTCAGGAGCAATGCAAAGGAGG - Intergenic
1088697596 11:112381776-112381798 TACCAGCAGCCAGGCCACGGTGG - Intergenic
1088791671 11:113232099-113232121 TGCCAGGAGACAGGATATGGGGG + Intronic
1088914010 11:114213129-114213151 CTACAGCAGCCAGGCCATGGTGG - Intronic
1089168773 11:116498347-116498369 CATGAGGAGCCAGGCCATGCTGG - Intergenic
1089613517 11:119682505-119682527 TGTTAGGAGCCAGGCAGTAGGGG + Intronic
1089644887 11:119872393-119872415 AGGAAGGAGCCAGGCCATGGAGG - Intergenic
1089922803 11:122226820-122226842 TGGGAGGAGCCAGTGCATGGAGG + Intergenic
1091015452 11:132047155-132047177 TGTCAGATCCCAGCCCATGGGGG - Intronic
1091299392 11:134497879-134497901 GGGCAAGAGCCAGGCCTTGGAGG + Intergenic
1092088841 12:5787361-5787383 TGTGGGGAGCCAGGTCACGGAGG - Intronic
1092236971 12:6816403-6816425 GGTGAGGGGCCAGGCCAGGGAGG + Exonic
1093169564 12:15844695-15844717 CGACTGGAGCCAGGTCATGGAGG + Intronic
1094073722 12:26449723-26449745 TCCCATGAGCCAAGCCATGGAGG + Intronic
1094531525 12:31279691-31279713 AGTCAGCAGCCAGGCCATGCAGG + Intergenic
1095348222 12:41178180-41178202 TTTCAGTAGGCTGGCCATGGTGG - Intergenic
1096181064 12:49550578-49550600 TGAAAGGAGCCAGTCTATGGGGG + Intronic
1096193028 12:49632526-49632548 CCCCAGGACCCAGGCCATGGGGG - Intronic
1098161544 12:67650394-67650416 TGGCTGGAGCCAGGCCTGGGAGG - Intronic
1098519652 12:71421045-71421067 TGTGAGCAGCCTGGGCATGGTGG - Intronic
1101460764 12:104890947-104890969 TGCCTGGAGACTGGCCATGGAGG - Intronic
1101811775 12:108113536-108113558 GGTCAGGAGCCCAGCCTTGGGGG - Intergenic
1103960703 12:124607417-124607439 TGGAAGGGGCCAGGTCATGGGGG - Intergenic
1104469844 12:129020752-129020774 TGCCAGGAGGCAGGCATTGGTGG + Intergenic
1104695173 12:130858033-130858055 GGTCAGGAGCTAGGACATGTGGG - Intergenic
1104776388 12:131392471-131392493 TCTCAGGTGCCAGGGCATGGGGG + Intergenic
1104778164 12:131403388-131403410 TGTCAGTGGCCAGGCCTTGGTGG + Intergenic
1104842412 12:131831424-131831446 CGGCAGAAGCCAGGACATGGAGG - Intronic
1105639990 13:22252489-22252511 TGTCTGGAGCCATGGCAGGGCGG - Intergenic
1106076420 13:26464913-26464935 AGTGAGGGGCCAGGCCATGGAGG + Intergenic
1106376330 13:29191697-29191719 TGTCATGAGCCAGGGAATGGTGG - Intronic
1109493414 13:63133427-63133449 AGTAAAGAGGCAGGCCATGGTGG - Intergenic
1110296986 13:73878904-73878926 GGTGAGGAGCAAGGCTATGGAGG + Intronic
1112294492 13:98174949-98174971 TGTCTGCAACCTGGCCATGGTGG + Intronic
1113743272 13:112725418-112725440 TGGCAGGGGCCAGGCGATGGGGG - Intronic
1115355672 14:32443983-32444005 TGTCTGGAGCCAAGGCATGATGG + Intronic
1115410524 14:33068904-33068926 TGGCAGGAGACAGGTCAGGGAGG + Intronic
1117434905 14:55706634-55706656 GGTCATAAGCCAGGCCAAGGAGG + Intergenic
1117865688 14:60146893-60146915 TGCCAGGAGCCAGAAGATGGAGG + Exonic
1119029128 14:71177648-71177670 TGACTGGAGCCAGGCCTTGATGG + Intergenic
1119774418 14:77239597-77239619 TGGCAGGCGCCATGCCATGCGGG + Exonic
1121570690 14:94944571-94944593 TGTTAGGGGGCAGGCCTTGGGGG + Intergenic
1121586973 14:95069187-95069209 GGGCAGAACCCAGGCCATGGTGG + Intergenic
1122862272 14:104587964-104587986 TGGCAGGGCCCAGGACATGGGGG + Intronic
1122878465 14:104679394-104679416 TGGCTGGAGCCAGGTCAGGGAGG + Intergenic
1123934996 15:25189810-25189832 GGCCAAGAGCCAGGCCACGGGGG + Intergenic
1123939167 15:25208478-25208500 GGCCATGAGCCAGGCCATGTGGG + Intergenic
1123943809 15:25229360-25229382 GGTCATGAGCCAGACCATGGGGG + Intergenic
1123944981 15:25234645-25234667 GGCCATGAGCCAGGCCATGTGGG + Intergenic
1124597490 15:31102871-31102893 ACTCGGGAGCCAGGCCAGGGAGG - Intronic
1124624494 15:31300253-31300275 TAGCAGGAGCCAGGCCAGGCAGG - Intergenic
1125825470 15:42672747-42672769 TGTCAGCAGCCAGAGCAGGGAGG - Intronic
1127025041 15:54795335-54795357 TGTCAGAATCCAGGTCATGGAGG + Intergenic
1127262731 15:57337851-57337873 TGCCAGGAGAGAAGCCATGGTGG + Intergenic
1127561171 15:60137840-60137862 CATCAGGGGCCAAGCCATGGAGG - Intergenic
1128700879 15:69803395-69803417 CGCCAAGATCCAGGCCATGGAGG - Intergenic
1128740849 15:70082800-70082822 AGTGAGGAGCCAGGGCAGGGAGG + Intronic
1128937330 15:71757961-71757983 TGTCAGCAGCCTGCCCCTGGAGG + Exonic
1129455809 15:75675705-75675727 TGTCACCAGCCAGGCCGTTGCGG + Exonic
1129624493 15:77182502-77182524 TGTTGGGAGGCAGGCCAAGGTGG + Intronic
1130209465 15:81909996-81910018 TGTCAGCAGCAAGCCCATGTTGG - Intergenic
1130375386 15:83324388-83324410 GCTCAGAAACCAGGCCATGGAGG + Intergenic
1130684058 15:86021826-86021848 AGACAGGAGCCAGGCCCTGGTGG + Intergenic
1132623510 16:879339-879361 TGGGAGGAGCCAGTCCTTGGAGG + Intronic
1132650952 16:1021260-1021282 TGTGGGGACACAGGCCATGGGGG - Intergenic
1132879764 16:2156932-2156954 TGTCTTGAGCCAGGCCAGAGTGG + Intronic
1133741993 16:8658833-8658855 AGGCAGGGGCCAGGCCTTGGAGG - Intergenic
1133828173 16:9297608-9297630 TGCCAGGAGCGATGCAATGGAGG + Intergenic
1134832838 16:17337470-17337492 TCTCAGGAGGCCGGGCATGGTGG - Intronic
1135967241 16:27046250-27046272 TGTCAGCAGCCAGTCCATGCAGG - Intergenic
1136139692 16:28280950-28280972 TGTCAGGAGCCAGGCGTGGGCGG - Intergenic
1136516533 16:30771985-30772007 GGTGAGGGGCCAGGCCAGGGTGG + Intronic
1136610784 16:31363730-31363752 TGGCAGGGGCCTGGGCATGGTGG - Intronic
1137458993 16:48640720-48640742 GGGCAGGAGCCAGGCCAAAGAGG - Intergenic
1137694209 16:50450278-50450300 AGGCAGGCGCCAGGCCAAGGGGG - Intergenic
1137848002 16:51710718-51710740 TGGCTGGAGCCAGGCTCTGGAGG - Intergenic
1138395695 16:56702934-56702956 TGTTAGGAGCAAGGCCATCTGGG + Intronic
1138692071 16:58777462-58777484 TGCCAAGCTCCAGGCCATGGAGG + Intergenic
1139206411 16:65033525-65033547 GGTCAGGAGACAGGCCATCCTGG + Intronic
1139594572 16:67950279-67950301 TGGGAGCAGCCAGGCCATGGGGG + Intronic
1141186746 16:81793086-81793108 TGCCAGAGGCCAGGCCTTGGGGG - Intronic
1142037636 16:87871517-87871539 TGCCAGGAGCCTGGCTCTGGGGG - Intergenic
1142141625 16:88475256-88475278 TGGCAGGGCCCAGGCCCTGGGGG + Intronic
1142235088 16:88918324-88918346 GGACAGGGCCCAGGCCATGGTGG - Intronic
1142713606 17:1736409-1736431 CAGCAGGAGGCAGGCCATGGGGG + Intronic
1142890523 17:2940029-2940051 TCTCGGGACCCAGGCCCTGGCGG + Intronic
1143124909 17:4635891-4635913 GGCCAGAAGCCAGGCCATTGGGG + Exonic
1143300922 17:5910141-5910163 TGTCAAGAGCCAGCACGTGGGGG + Intronic
1143432404 17:6896609-6896631 GGCCAGGAGCCAGGCCATGGGGG - Intronic
1143444857 17:7001657-7001679 TGCCAGGAGCCAGGCAAGTGGGG - Exonic
1143898800 17:10157598-10157620 TGTCAGGAGCCAGGAAATGCTGG - Intronic
1143902433 17:10184251-10184273 TGCCAGGAGCCTGGCTAAGGAGG - Intronic
1144483274 17:15644756-15644778 TGTCGGGTGCCAGGAAATGGGGG + Intronic
1144672989 17:17143445-17143467 CGCCAGGAGCAAGGCCCTGGCGG + Intronic
1144915411 17:18720273-18720295 TGTCGGGTGCCAGGAAATGGGGG - Intronic
1145064216 17:19751049-19751071 AGCCAGGAGCCAGGCCAGGCAGG - Intergenic
1147899547 17:43775040-43775062 TGGCAGGGGCCAGAGCATGGAGG - Intronic
1148587348 17:48790483-48790505 ATTCAGGAGCCTGGCCAGGGTGG + Intronic
1148697794 17:49571434-49571456 TGGCAGGGGCCAGACCATGCAGG - Intergenic
1148889081 17:50794735-50794757 TGGCAGGGGGCAGGGCATGGTGG + Intergenic
1150144390 17:62755439-62755461 TGACAGCAGGCAGGCCTTGGAGG + Intronic
1151833823 17:76570543-76570565 GGTGAGCAGCCAGGCCGTGGTGG - Exonic
1152406963 17:80103342-80103364 TCCTAGGAGCAAGGCCATGGGGG - Intergenic
1152929423 17:83102260-83102282 GGACAGGCACCAGGCCATGGTGG - Intergenic
1153262580 18:3238813-3238835 GGTCAGGAGCCAGGGAATGCAGG - Intergenic
1154242164 18:12662486-12662508 AGTCCTGAGCCCGGCCATGGGGG + Intronic
1154446229 18:14437895-14437917 TGGACGGACCCAGGCCATGGAGG - Intergenic
1157441958 18:47718449-47718471 TGGCAGGAGCCAGGGAATGCTGG - Intergenic
1158440211 18:57468572-57468594 TGGGAGGAGCCAGGCCTTGATGG - Intronic
1161252865 19:3290409-3290431 TGTCAGGGGGCAGGCGAGGGAGG - Intronic
1161373076 19:3924425-3924447 TGGCAGGAGCCGGGCCCTGAAGG + Intronic
1161408032 19:4101316-4101338 GGTCAGGAGCTAAGCCCTGGTGG - Intronic
1162567314 19:11451613-11451635 GGGCAGGGGCCAGGCCAGGGGGG - Exonic
1163035433 19:14566595-14566617 TGCCAGGGGCCAGGCCTGGGTGG + Intronic
1163262885 19:16201872-16201894 TGTGAGGAGCCAGACCACGCTGG + Intronic
1163283332 19:16330691-16330713 TGTCAGGTGCCAGGGCTGGGTGG + Intergenic
1163336778 19:16678007-16678029 TGCCAGGGGCTAGGCGATGGGGG + Intronic
1163469453 19:17487960-17487982 TGACAGGAGCTGGGCCATCGTGG - Intronic
1163822930 19:19506445-19506467 TCCCAGGAGCAAGGCCAGGGTGG - Exonic
1164567412 19:29337203-29337225 GGGCAGCAGCCAGGCCATGGTGG - Intergenic
1164938149 19:32230779-32230801 TGCAAGGAGCAAGGACATGGTGG + Intergenic
1165728513 19:38129336-38129358 TGTCACGAGGCCGGGCATGGTGG + Intronic
1166184915 19:41133606-41133628 TGTCTGAGGCCAGGCCATGATGG - Intergenic
1166189387 19:41165793-41165815 AGTCAGAAGCCACGGCATGGAGG + Intergenic
1166719779 19:44990302-44990324 TGTGAGGATGCAGGCCAAGGGGG + Intronic
1167245223 19:48369145-48369167 ACTGAGGAGCCAGGCCAGGGGGG - Intronic
1167990746 19:53358438-53358460 GGACAGGAGCCAGGCCTGGGAGG - Intergenic
1168677877 19:58291953-58291975 TGAGACGAGCCAGGGCATGGTGG + Intronic
925814857 2:7737544-7737566 TGCCAGAGGCCAGCCCATGGAGG + Intergenic
925844130 2:8020424-8020446 AGGGAGGGGCCAGGCCATGGGGG + Intergenic
926065493 2:9836538-9836560 TGACAGGAGGGAGGCTATGGGGG - Intergenic
927130096 2:20051537-20051559 TGTCAGGGGCCCGGCCAAGAAGG - Exonic
927909235 2:26884909-26884931 TCTCAGGAGGCCGGGCATGGTGG + Intronic
928914398 2:36456063-36456085 TGTTAGCAGCCAGGCAATGGAGG + Intronic
929220663 2:39461922-39461944 GGTCAGGAGCCAGGCCAACATGG + Intergenic
929894577 2:45947296-45947318 TGCCAGGAGCCAGGGGGTGGGGG + Intronic
930060473 2:47284091-47284113 TGTCAGAAACCAGGCCATAGGGG + Intergenic
931105442 2:59050137-59050159 TGTCAGGGGCCAGGGAGTGGAGG - Intergenic
931357361 2:61548876-61548898 TGTCATGAGCCCGGGGATGGTGG - Intergenic
933780111 2:85795424-85795446 TGCAAGGAACCAGGCCACGGGGG - Intergenic
934558796 2:95301583-95301605 TGCCAGGGGCCAGGCCAAGCTGG - Intronic
934563029 2:95323053-95323075 CGTTAGGAGGCAGGCAATGGGGG - Intronic
934695892 2:96399915-96399937 TGTCAGGAGCAGGGCCTTGTGGG - Intergenic
934697438 2:96410157-96410179 AGTCAGGAGGCAGCCCAGGGTGG - Intergenic
934896083 2:98121474-98121496 TGGCTGGCCCCAGGCCATGGAGG + Intronic
935157041 2:100492672-100492694 AGCCAGGGGCCAGGTCATGGTGG + Intergenic
935767888 2:106387138-106387160 GGTCAGGGGCCAGGGCAGGGTGG + Intergenic
936115819 2:109702188-109702210 TGACAGAGACCAGGCCATGGAGG + Intergenic
936965994 2:118128072-118128094 TGGCAGGAGCCAGGTCCTGAAGG - Intergenic
937195100 2:120147353-120147375 TCTAAGGGGCCAGGCCGTGGTGG + Intronic
937332019 2:121037621-121037643 TGGCAGGGGCCAGGCCATGCAGG - Intergenic
937335221 2:121058429-121058451 TGGCAGGAGGCAGCCCCTGGAGG + Intergenic
943230365 2:185243040-185243062 TGTCAGTAGCCAGGGGGTGGCGG + Intergenic
944020161 2:195093424-195093446 TGACAGGATCCAGGCCACTGTGG + Intergenic
946616706 2:221517823-221517845 GGTCAGGACCCAGGGCCTGGTGG - Intronic
946663708 2:222028103-222028125 GGTCAAGAGGCAGGGCATGGTGG + Intergenic
946772870 2:223107393-223107415 TGTCAAGAGGCCGGGCATGGTGG + Intronic
947637637 2:231688184-231688206 GGTTTGGTGCCAGGCCATGGTGG + Intergenic
947758775 2:232588240-232588262 TGGCTGGAGCCAGGGCATGGTGG - Intergenic
948581196 2:238988275-238988297 TGTCTGCAGCCACGCCCTGGGGG - Intergenic
1169400509 20:5275345-5275367 TGGCAGTAGCCAGGCCATGATGG + Intergenic
1169805521 20:9555569-9555591 TTTCCGGAGTCAGGCCAGGGAGG + Intronic
1170573928 20:17648466-17648488 TGACAGGAAGCAGGCCAAGGAGG + Intronic
1170732187 20:18985096-18985118 GTGCAGGAGCCAGGCCCTGGAGG + Intergenic
1171456498 20:25275575-25275597 TGGCTGGGGCCATGCCATGGAGG + Intronic
1172696674 20:36827877-36827899 TGTTATGGGCCAGGCCATGGGGG + Intronic
1173325121 20:42026228-42026250 AGACAGGAGCCAGACCATGCTGG + Intergenic
1174295076 20:49540032-49540054 TGTCAGGTGCCAGGTGAGGGAGG + Intronic
1174616500 20:51839496-51839518 TGCCAGGAGCCAGGTCGAGGAGG + Intergenic
1174657425 20:52183228-52183250 TGGCATCAGCCAGGCCAAGGTGG + Intronic
1174862050 20:54099960-54099982 AGCCAGGAGTAAGGCCATGGTGG + Intergenic
1175168511 20:57063209-57063231 TGGCAGCAGGTAGGCCATGGGGG + Intergenic
1175218678 20:57404836-57404858 TGGCAGGTGCCAGGCCCAGGTGG + Intronic
1175305678 20:57974047-57974069 TGGCAGGAGCCAGCACCTGGTGG - Intergenic
1176261370 20:64182609-64182631 TGACACGAGACAGGCCACGGAGG - Intronic
1176449753 21:6851951-6851973 TGGATGGACCCAGGCCATGGAGG + Intergenic
1176816852 21:13610766-13610788 TGGGAGGAGGCAGGACATGGGGG + Intronic
1176827925 21:13716975-13716997 TGGATGGACCCAGGCCATGGAGG + Intergenic
1179505578 21:41837865-41837887 TGGCAGCAGCCAGGCCATTCTGG - Intronic
1179553933 21:42160540-42160562 TGTCCGGTGCCAGGCCAGGGGGG + Intergenic
1179902563 21:44401626-44401648 GGTCAGGACCCTGGCCCTGGTGG + Intronic
1179936454 21:44608304-44608326 TCTCATGAGCCAGGGCATGCTGG - Intronic
1180000529 21:44993482-44993504 TGCCAGGAGCCGGGTCCTGGTGG - Intergenic
1180722479 22:17919805-17919827 TGTCAGGAGCCAGGACCTGGAGG + Intronic
1180842209 22:18964709-18964731 TCCCAGGAGGCCGGCCATGGTGG - Intergenic
1180980654 22:19876629-19876651 CTGCAGGAGCCAGGCCTTGGTGG + Intronic
1181023275 22:20114286-20114308 CGGCAGGAGGGAGGCCATGGTGG - Intronic
1181059290 22:20274172-20274194 TCCCAGGAGGCCGGCCATGGTGG + Intronic
1181276332 22:21689268-21689290 TGGCAGGAGGCAGGGGATGGGGG + Intronic
1181368035 22:22394860-22394882 TGTGAGGGGCCAGCCCAGGGAGG - Intergenic
1181509928 22:23384637-23384659 AGTCGGGAACCAGGCCAGGGAGG - Intergenic
1181541988 22:23578528-23578550 CACCAGGAGCCCGGCCATGGAGG - Intronic
1181917171 22:26290721-26290743 AGGCAGGGGCCAGGCCCTGGAGG - Intronic
1182242135 22:28924460-28924482 GGTAAGCAGCCAGGGCATGGTGG + Intronic
1183310429 22:37106740-37106762 GGACAGCAGCCTGGCCATGGAGG - Intronic
1183355915 22:37359360-37359382 TGGCAGGGGCCTGGCCAGGGAGG - Intergenic
1184432716 22:44450719-44450741 TGACAGGAGCCATGCCCTGGTGG + Intergenic
1184762135 22:46550671-46550693 TGTCGGGAGCTGGGCCATGGAGG + Intergenic
1184788042 22:46681208-46681230 TCACTGGAGCCGGGCCATGGAGG + Intergenic
1185375711 22:50481843-50481865 CGTCGGGATCCGGGCCATGGCGG - Exonic
950515192 3:13460506-13460528 TTTCCGGCGCCAGGCCATGGGGG - Intergenic
951218340 3:20044515-20044537 TAGCAGTAGCCAGGCCATGCAGG - Intronic
953390774 3:42532465-42532487 TGGGCTGAGCCAGGCCATGGTGG - Intronic
953436317 3:42880752-42880774 TGTCCGGGGCCAGCCCACGGGGG + Intronic
954003976 3:47578180-47578202 TCTGAAGAGCCAGGCCAGGGCGG + Intronic
954115470 3:48464774-48464796 TGTTAGGGTGCAGGCCATGGTGG + Intronic
954448881 3:50561122-50561144 AGTCAGGAGGCAGGGCCTGGAGG - Intronic
954780063 3:53052127-53052149 TTGCAGGAGCCAAGACATGGAGG - Intronic
955575114 3:60352852-60352874 TGTCAGGTGCCAGGAAATAGGGG + Intronic
955842059 3:63123202-63123224 AAGCAGGAGCCAGACCATGGAGG + Intergenic
960406163 3:117262419-117262441 AGGCTGGAGCCAGGTCATGGTGG - Intergenic
962371675 3:134825767-134825789 TGCCATGAGCCAAACCATGGTGG - Intronic
965953734 3:174342744-174342766 CATCAGAGGCCAGGCCATGGAGG + Intergenic
966396804 3:179512164-179512186 TGTCAGGTGCCTGGCCTGGGAGG - Intergenic
966865901 3:184259169-184259191 TCTCAGGAGCCAGGCCAAAATGG - Intronic
967117240 3:186352951-186352973 GGACAGGAGCTGGGCCATGGAGG - Intronic
968446126 4:653237-653259 TGTGAGGAGGCAGGGCCTGGTGG + Intronic
968454999 4:693186-693208 TATCAGCAGCCGGGCCCTGGAGG - Intergenic
969056677 4:4406873-4406895 TGGCAGGAGCCCAGCCAGGGAGG - Intronic
969101829 4:4775180-4775202 TGAGAGGAGCCAGGGGATGGGGG + Intergenic
969608514 4:8214221-8214243 GGTGAGGAGCCAGGGCATGGGGG + Intronic
969816583 4:9691816-9691838 GCTCAGGAGGCGGGCCATGGGGG - Intergenic
969928984 4:10611906-10611928 TGTCAGGGACCAGACCATGGAGG - Intronic
970377638 4:15475395-15475417 TGTCAGGATCAAGGGCCTGGAGG + Intronic
970401537 4:15721986-15722008 AGACAGGAGCCAGGTCTTGGTGG - Intronic
971182429 4:24341954-24341976 AGCCAGGAGCCAGATCATGGAGG + Intergenic
974067281 4:57090547-57090569 TGTGAGAAGGCAGGGCATGGTGG + Intronic
974504877 4:62756914-62756936 TGTCCTGGGCCAGGCCATAGTGG + Intergenic
979252874 4:118583792-118583814 TGTCAGGAGGCTGGGCAAGGTGG + Intergenic
981045477 4:140261265-140261287 AGTCAGGAGCCAGAGCAAGGGGG - Intronic
981259782 4:142706012-142706034 TGGCAGAGGCCAGGCCATGAAGG - Intronic
981980101 4:150781519-150781541 TGTTAGAAACCAGGCCATGCAGG - Intronic
983257313 4:165415058-165415080 TGTCAGCAGCAAGGCTAAGGAGG - Intronic
984693287 4:182753233-182753255 AGTAAGGAGGCAGGGCATGGTGG - Intronic
985279948 4:188276256-188276278 TGTAAGTAGGCAGGGCATGGTGG + Intergenic
985286396 4:188340544-188340566 TGCCAGGAGGCTGGCCATGGTGG - Intergenic
986220400 5:5763774-5763796 TGTCAGGAGTGAGGGCATGGAGG - Intergenic
986968330 5:13302262-13302284 GGTCGGGAGTCAGGGCATGGGGG + Intergenic
987035646 5:14015584-14015606 TCTCAGGAGGCTGGGCATGGTGG - Intergenic
990724625 5:58740127-58740149 GATCAGGAGCCAGGCCAGGCAGG + Intronic
990974808 5:61550113-61550135 CGTCTGGGGCCAAGCCATGGTGG - Intergenic
992085538 5:73275015-73275037 TTTCAGCAGCCAGGGCTTGGCGG + Intergenic
994072807 5:95620769-95620791 TGCCAGCAGCCAGCCCAGGGCGG - Exonic
997038171 5:130218166-130218188 AGTGAGGTGCCAGGCCATGTAGG + Intergenic
997295538 5:132766251-132766273 AGTCAGGAGCCAGGAGCTGGGGG - Intronic
997418909 5:133750665-133750687 TGTTAGGAGCCGGGACAGGGAGG - Intergenic
997427334 5:133812383-133812405 TGTCAGGGGACAGATCATGGGGG - Intergenic
998375333 5:141686926-141686948 TCTCAGGGGCCAGGCCATGCAGG + Intergenic
999075417 5:148791009-148791031 TGTCAGGATCCAGGAAATGATGG + Intergenic
999132776 5:149297250-149297272 TGGCAGGGCCCAGGCCCTGGAGG + Intronic
1000357819 5:160417878-160417900 AGGCAGGTGCCAGACCATGGTGG - Intronic
1001168530 5:169393794-169393816 AGCAAGGAGCCAGGCCATGCTGG - Intergenic
1001324093 5:170707578-170707600 TCTCAGGAGCAGGGCGATGGTGG - Intronic
1001536088 5:172498817-172498839 TGCCCTGAGCCAGGCCCTGGAGG - Intergenic
1002098785 5:176847174-176847196 CGGCTGGAGCCAGGCCCTGGTGG + Intronic
1002279929 5:178124115-178124137 TGACAGGCCCCTGGCCATGGAGG - Exonic
1002518065 5:179774091-179774113 TGCCAGAAGCCATGCCATAGAGG - Exonic
1004917426 6:20345022-20345044 TGTAAGGAGCCAAGCCATGCAGG - Intergenic
1005708808 6:28483868-28483890 TGACAGTAGCCTGGGCATGGTGG - Intergenic
1005941265 6:30561992-30562014 TTTCCGGGGCCAGGCCATGGGGG + Exonic
1007067589 6:39007636-39007658 AGGCAGGAGCCAGACCATGCAGG - Intronic
1007386424 6:41523297-41523319 TGGCAGCACCCAGGCCATGGAGG + Intergenic
1007418039 6:41703419-41703441 GGGCAGGAGCCAGGCACTGGCGG - Intronic
1007659828 6:43477380-43477402 TGTCAGGAGCAGGGCAATAGCGG - Intergenic
1010963783 6:82178934-82178956 TGGCAGGAGCCAGACTATGTAGG + Intronic
1011964431 6:93136408-93136430 TTTCAGGAGGCAGGGAATGGAGG - Intergenic
1013044289 6:106469043-106469065 GGGCAGGAGCCAGGCCACGCAGG - Intergenic
1013327523 6:109062407-109062429 GGTCAGCAGCCACACCATGGAGG + Intronic
1014209760 6:118695981-118696003 TGTTAGGAGGCGGGGCATGGTGG + Intronic
1014855491 6:126396163-126396185 TGTCAGGAGCCAGGGACTAGAGG + Intergenic
1015044126 6:128759073-128759095 TGTCAGGAACCAGGTGATGTAGG + Intergenic
1015059889 6:128950428-128950450 GGTGAGGAGCCAGGCCACGTGGG + Intronic
1015623851 6:135159694-135159716 TGACAGGAAACTGGCCATGGGGG + Intergenic
1015833939 6:137399105-137399127 TGAGGGGAGCCAGGCCCTGGGGG - Intergenic
1016037492 6:139397995-139398017 TGTCAGGGACCAGGGCATGAAGG - Intergenic
1017951855 6:159141848-159141870 TGTTAGCAGCAAGGCCATGTAGG + Intergenic
1018136605 6:160783963-160783985 GGTCAGGGGCCAGGGCAGGGTGG + Intergenic
1018682348 6:166275083-166275105 TGGCAGCAGCCTGGCCAGGGAGG - Intergenic
1019381041 7:723751-723773 TGGGTGGGGCCAGGCCATGGGGG - Intronic
1019803954 7:3108865-3108887 TGTCTGGAGCCAGCCCAGGGAGG + Intergenic
1022669304 7:32440950-32440972 TGGCAGGAGCAAGGCCAAGGGGG + Intergenic
1023883508 7:44334967-44334989 TGGCAGGAGCCCGGCCAGGCTGG - Intergenic
1024034705 7:45497510-45497532 TGTCAGGAGCCATTCCATCATGG - Intergenic
1025914175 7:65852390-65852412 TGTCAAGAGACTGGACATGGAGG + Intergenic
1025975580 7:66367011-66367033 TGTCAAGAGACTGGACATGGAGG - Intronic
1026129388 7:67607500-67607522 TGACAGAAGTAAGGCCATGGAGG + Intergenic
1027859738 7:83562365-83562387 TGGCAGGAGCCAGAGCAAGGTGG - Intronic
1027990322 7:85351459-85351481 CGTTAGGAGGGAGGCCATGGTGG + Intergenic
1029551659 7:101239924-101239946 TGTCAGGAGCCCGGCCCCTGCGG + Intronic
1030061327 7:105623632-105623654 TGTCAGGGGCCAGCCCTTGTTGG - Intronic
1030603922 7:111619089-111619111 TGTCAAGAGGCTGGGCATGGTGG - Intergenic
1031774669 7:125892649-125892671 AGTGAGGAGTCAAGCCATGGTGG - Intergenic
1032443121 7:131957640-131957662 GGTGAGGAGACAGGCCTTGGAGG - Intergenic
1033129736 7:138735551-138735573 TGTCCTGAGCCAGGCCAGAGGGG + Intronic
1033198909 7:139351611-139351633 TGGCAAGGGCCAGGCCCTGGAGG - Intronic
1033765110 7:144480818-144480840 GGTCAGAAGCCAGGCCTTTGGGG + Intronic
1034301805 7:150022524-150022546 TGTCAAGAACCAGGGCAGGGAGG - Intergenic
1034574536 7:151985746-151985768 CGCCATGAGCCAGGCCCTGGAGG - Intronic
1034804239 7:154074739-154074761 TGTCAAGAACCAGGGCAGGGAGG + Intronic
1035079145 7:156201858-156201880 TGTCAGGAGCCAGTCCAAGGTGG + Intergenic
1036592984 8:10185655-10185677 CTTCAAGAGCCAGGCCCTGGTGG + Intronic
1036949005 8:13123235-13123257 TGACAGGGGCCAGGACATGTGGG - Intronic
1038440219 8:27566200-27566222 TGTCAGGAGCCACCCTTTGGAGG + Intergenic
1039044783 8:33439924-33439946 AGTCAGGAGCCAGGCCATCAGGG - Intronic
1040469561 8:47725993-47726015 GGGCAGGAGCCAGGCCACAGTGG + Intronic
1040493874 8:47949099-47949121 CGGCAGGAGCCAAGGCATGGGGG - Intronic
1042797815 8:72683891-72683913 TGGCAGGAGCTAGGTCATGAAGG + Intronic
1043045189 8:75314315-75314337 AGGCAGGAGCCAGACCATGAAGG - Intergenic
1044959318 8:97515069-97515091 TGGCAGGAGTCAGACCTTGGAGG - Intergenic
1047336333 8:123940213-123940235 TGGCAGGAGGCAGAGCATGGGGG + Intronic
1047342450 8:123994961-123994983 TCTCACAATCCAGGCCATGGAGG - Intronic
1048171883 8:132115158-132115180 TATCAGGGGTCAGGCCATGAAGG - Intergenic
1048321897 8:133406512-133406534 TTTCAGGAGGCAGGCTATGCGGG + Intergenic
1048965461 8:139611467-139611489 GGGCAGGAGCCAGGCCACAGAGG + Intronic
1049240192 8:141533835-141533857 AGCCAGGAGCCAGCCAATGGAGG + Intergenic
1049427268 8:142543053-142543075 GGCCAGGAGCCAGGATATGGTGG - Intronic
1050290256 9:4147034-4147056 TGTCAGGTGCTAGGTCAGGGTGG - Intronic
1050381965 9:5040916-5040938 TGCCGGCAGCCTGGCCATGGCGG + Intronic
1052774963 9:32723988-32724010 TATCATTAGCCAGGCCAAGGAGG + Intergenic
1052859888 9:33431110-33431132 AGGCAGGATCCAGGCCAGGGAGG - Intergenic
1053458389 9:38249637-38249659 TGGCAGCAGCTAAGCCATGGAGG + Intergenic
1053747530 9:41214851-41214873 TCTCAGGAAACAGGTCATGGAGG + Intergenic
1054479755 9:65650517-65650539 TCTCAGGAAACAGGTCATGGAGG - Intergenic
1054914703 9:70485305-70485327 TGTCAGGAGCCAGGACAGGCAGG + Intergenic
1056127842 9:83554539-83554561 TGTCTGGTGACAAGCCATGGAGG + Intergenic
1056912302 9:90713405-90713427 TGTCTGGAGCCAGGACATCCTGG - Intergenic
1057835237 9:98439284-98439306 TCACAGGAGGCAGGCCCTGGAGG - Intronic
1057891287 9:98871919-98871941 AGTCAGGGGCCAGGTCAAGGAGG - Intergenic
1058420446 9:104828287-104828309 TGTCAGGAGGGAGGCCTTGGGGG + Intronic
1059482692 9:114603933-114603955 TGTTAGCAGGCAGGGCATGGTGG - Intergenic
1060207947 9:121693578-121693600 TGGGAGGAGCCGGGCCTTGGCGG + Intronic
1061419181 9:130464067-130464089 TGTCAGGAGCCACAGGATGGGGG - Intronic
1062277014 9:135736071-135736093 TGTCAGGGCACAGCCCATGGGGG - Intronic
1062322996 9:135999482-135999504 TGTCAGCAGCCAGGCAGGGGCGG + Intergenic
1202783662 9_KI270718v1_random:25622-25644 TCTCAGGAAACAGGTCATGGAGG + Intergenic
1203794417 EBV:169030-169052 TGTCAGGAGCAAGGCAGTTGAGG + Intergenic
1203519431 Un_GL000213v1:32566-32588 TGGATGGACCCAGGCCATGGAGG - Intergenic
1186896458 X:14008993-14009015 TGCCAAGATCCAAGCCATGGAGG - Exonic
1189766010 X:44372874-44372896 TGACAGGAGGCCGGGCATGGTGG + Intergenic
1190780794 X:53592947-53592969 TGGCAGGAGCCAGGAGGTGGAGG - Intronic
1191683914 X:63869595-63869617 GGCCAGAAGCCAGGCTATGGGGG - Intergenic
1194142830 X:90226582-90226604 GGTCTGGTGCCTGGCCATGGGGG + Intergenic
1195682928 X:107562283-107562305 TGGCAGGAGCCAGTTCATGGAGG + Intronic
1199180466 X:144848253-144848275 TGTCAGGCCCAAGGCCCTGGTGG - Intergenic
1200045990 X:153401201-153401223 TGCCAGGACCCAGGCCCAGGAGG - Intergenic
1200291656 X:154881260-154881282 AGGCAGGAGCCAAGACATGGAGG - Intronic
1200338491 X:155376951-155376973 AGGCAGGAGCCAAGACATGGAGG - Intergenic
1200347978 X:155463741-155463763 AGGCAGGAGCCAAGACATGGAGG + Intergenic
1200827128 Y:7657449-7657471 AGCCAGGAGGCAGGGCATGGGGG + Intergenic