ID: 1070605966

View in Genome Browser
Species Human (GRCh38)
Location 10:77898725-77898747
Sequence GCCTGTCAGGAGCCAGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 349}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605966_1070605974 8 Left 1070605966 10:77898725-77898747 CCATGGCCTGGCTCCTGACAGGC 0: 1
1: 0
2: 3
3: 44
4: 349
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605966_1070605978 22 Left 1070605966 10:77898725-77898747 CCATGGCCTGGCTCCTGACAGGC 0: 1
1: 0
2: 3
3: 44
4: 349
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605966_1070605973 5 Left 1070605966 10:77898725-77898747 CCATGGCCTGGCTCCTGACAGGC 0: 1
1: 0
2: 3
3: 44
4: 349
Right 1070605973 10:77898753-77898775 CATGCCTGAGAGGGCCAGGCAGG No data
1070605966_1070605976 13 Left 1070605966 10:77898725-77898747 CCATGGCCTGGCTCCTGACAGGC 0: 1
1: 0
2: 3
3: 44
4: 349
Right 1070605976 10:77898761-77898783 AGAGGGCCAGGCAGGCGGTAAGG No data
1070605966_1070605970 -4 Left 1070605966 10:77898725-77898747 CCATGGCCTGGCTCCTGACAGGC 0: 1
1: 0
2: 3
3: 44
4: 349
Right 1070605970 10:77898744-77898766 AGGCCTGTGCATGCCTGAGAGGG No data
1070605966_1070605972 1 Left 1070605966 10:77898725-77898747 CCATGGCCTGGCTCCTGACAGGC 0: 1
1: 0
2: 3
3: 44
4: 349
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605966_1070605969 -5 Left 1070605966 10:77898725-77898747 CCATGGCCTGGCTCCTGACAGGC 0: 1
1: 0
2: 3
3: 44
4: 349
Right 1070605969 10:77898743-77898765 CAGGCCTGTGCATGCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605966 Original CRISPR GCCTGTCAGGAGCCAGGCCA TGG (reversed) Intronic
900243533 1:1627664-1627686 TCCTGTCAGGAACCAGCCCGAGG + Exonic
900432247 1:2607865-2607887 GCCTGTGATGAGGCAGGCCCCGG + Intronic
900516526 1:3084820-3084842 GGCTGTCGGGGGGCAGGCCAGGG + Intronic
901455292 1:9359769-9359791 GCCTCTGAGAGGCCAGGCCAGGG + Intronic
901777432 1:11569947-11569969 CCCTGGCAGGAACCAGGGCAGGG + Intergenic
902436196 1:16399381-16399403 GGATGTCAGGATCCAGGCCAGGG + Exonic
902659596 1:17891919-17891941 GCCTGACAGCCTCCAGGCCAGGG + Intergenic
902820865 1:18942396-18942418 GGCTGGTGGGAGCCAGGCCAGGG + Intronic
903336327 1:22627022-22627044 GACTCTCAGGAGCCAGGCAGGGG + Intergenic
903952832 1:27006040-27006062 GCCTGGAGGGCGCCAGGCCAGGG + Exonic
905246064 1:36614689-36614711 ACCTGCCAGGAGCCTTGCCATGG - Intergenic
905546992 1:38807807-38807829 GCAGGTCAGGACGCAGGCCAGGG - Intergenic
905675175 1:39819628-39819650 GCCTGCCAGGTGCCAGGGCGCGG + Intergenic
905969592 1:42131487-42131509 GCCTTTGGGAAGCCAGGCCAGGG - Intergenic
906695638 1:47821525-47821547 GCCTGTCAGGGGCATTGCCAGGG - Intronic
907308855 1:53528114-53528136 GCCTCTCAGGACCTGGGCCAGGG + Intronic
907378275 1:54062843-54062865 GAATGTCAGGAGCCAAGTCATGG + Intronic
907464416 1:54625269-54625291 AGCTGCCAGGAGCCAGGCCCTGG + Intronic
907489922 1:54802162-54802184 GGATGGCAGGAGCCAGGCCCAGG - Intergenic
907655403 1:56337101-56337123 GGATCTAAGGAGCCAGGCCATGG + Intergenic
907927018 1:58964692-58964714 CCCTGTTAGGTGCCAGGCCCTGG + Intergenic
908748160 1:67395563-67395585 GTCTATCAGGAGCCTGTCCAAGG - Exonic
909365099 1:74811673-74811695 TCCTGTCACTAGCCAGGCTATGG + Intergenic
913089367 1:115466154-115466176 GCCAGTCAGGAGCAAAGCCAAGG + Intergenic
914210815 1:145577224-145577246 CCATGTCAAGAGCCAAGCCAAGG + Intergenic
914462464 1:147897691-147897713 GAGGGTCAGGAGGCAGGCCATGG - Intergenic
915451823 1:156010690-156010712 GACTGTCAGGGGCAAGACCAGGG - Intronic
917290442 1:173467112-173467134 GCCTGTCAGAGGACAGGGCATGG + Intergenic
917333959 1:173909726-173909748 GCCTGAGAAGAGCCTGGCCAAGG - Exonic
917666432 1:177230037-177230059 GTCTGTGAGCAGCCAGTCCAGGG - Exonic
917976633 1:180244128-180244150 GCCTGTTATGAGCCACGTCAGGG - Intronic
917978665 1:180256060-180256082 GCCATTCAGGTGCCATGCCATGG + Intronic
918385670 1:184005109-184005131 GCCTGCCTGGAACCAGGACAAGG + Intronic
919687784 1:200500206-200500228 GCTGGTCAGGAGCTAAGCCATGG + Intergenic
919867075 1:201790390-201790412 TCCTGTGAGGAGCCAGGGCCAGG + Intronic
922219767 1:223549613-223549635 GCTTGTGGGGAGCCAAGCCAAGG - Intronic
923316171 1:232782288-232782310 ACATGTCAGGAGCCAAGCTATGG + Intergenic
1062802161 10:388850-388872 CCCTGTCAGGAGCCTGGTCAAGG + Intronic
1064283350 10:13970651-13970673 CCCCTTCAAGAGCCAGGCCAAGG + Intronic
1065298810 10:24302257-24302279 GCATTTCAAGAGACAGGCCAGGG + Intronic
1065605448 10:27413713-27413735 CCCTGTGGGGAGCCCGGCCAAGG - Exonic
1067057114 10:43058755-43058777 GCGGGTCAGGAGCCTGGGCATGG + Intergenic
1067058122 10:43064252-43064274 GCCTGTCCTGAGTCAGCCCAGGG + Intergenic
1068181245 10:53521120-53521142 GCATTTCAAAAGCCAGGCCATGG - Intergenic
1068737386 10:60429648-60429670 GCCAGTTGGGAGCCAAGCCAGGG - Intronic
1069275627 10:66587530-66587552 GCATGTGAGGAGCCAGAGCAAGG - Intronic
1069807646 10:71136085-71136107 GCCTGGCAGGAACCAGGACAGGG + Intergenic
1069860600 10:71468805-71468827 GCCCGGCAGGAGACAGGGCAGGG + Intronic
1069864110 10:71490639-71490661 GCCTGTTCTGAGCCAGGCCCTGG - Intronic
1069897181 10:71687124-71687146 ACCTGCCAGCAGCCAGCCCAGGG + Intronic
1070492861 10:76993797-76993819 TCCTGGCAGGGGCCAGGCCAAGG - Intronic
1070605966 10:77898725-77898747 GCCTGTCAGGAGCCAGGCCATGG - Intronic
1070692645 10:78539075-78539097 GCCTGGCATAAGCCAGGACATGG - Intergenic
1071522374 10:86339315-86339337 GGCTGGCAGAGGCCAGGCCAGGG + Intronic
1073083012 10:100871676-100871698 TGGTGTCAGGGGCCAGGCCAGGG + Intergenic
1073138075 10:101230414-101230436 GCCCGGCGGGAGCCAGGCCGCGG + Intergenic
1073183571 10:101601672-101601694 TCCTGACTGGAGCCAGGCCTTGG + Intronic
1073667549 10:105550617-105550639 GCAAGTCAGCAGCCAGGCTAGGG + Intergenic
1075391585 10:122096324-122096346 TGCTGTCAGGAGCCAGTTCATGG - Intronic
1076391974 10:130110290-130110312 GCCTGCCACGTGCCAGGCCCAGG - Intergenic
1076704365 10:132293250-132293272 GCCCGCCAGGCGCCAGGCCTGGG - Intronic
1077105409 11:840160-840182 GGATGTCAGGAGCCAGGTCTAGG - Exonic
1077167736 11:1151405-1151427 GGCTGTCAGAGGCCCGGCCAGGG + Intergenic
1078653876 11:13220415-13220437 GCCTGGGAAGAGCCAGGCCTTGG - Intergenic
1078710565 11:13786941-13786963 GCCTGACAGGAGCCAGCAAAGGG + Intergenic
1078974907 11:16462685-16462707 GCCTGGCAGGTGCCAGGCACAGG - Intronic
1079110257 11:17601460-17601482 GCATGGCAGGAGCCAGGGCGTGG + Intronic
1081802520 11:45869759-45869781 GCGGGTCAGGAAGCAGGCCACGG - Exonic
1081806035 11:45891032-45891054 GTCCATCAGGAGCCAGGCCAAGG - Intronic
1081987724 11:47318699-47318721 GCCTCACAGGAGCCAGGTGATGG - Intronic
1082064099 11:47884914-47884936 GTGTGTCAGGAGCCTGGGCATGG + Intergenic
1083301177 11:61740293-61740315 GCAGGGCAGGAGCCAGGCCAGGG + Intronic
1083778402 11:64905913-64905935 GCCAGGCAGGGGCCAGGACAGGG - Intronic
1084215416 11:67644781-67644803 GCCTGCCAGGTGCCCGGCCTCGG + Exonic
1084482396 11:69429558-69429580 GCAGGTCAGGAGCCAGGACATGG - Intergenic
1084573279 11:69972861-69972883 GCCAGATAGGGGCCAGGCCAGGG - Intergenic
1085035554 11:73297710-73297732 ACCTCTCAAGAGCCAGGCCCAGG - Exonic
1085154671 11:74282554-74282576 GGTTGGCAGCAGCCAGGCCATGG + Intronic
1085273444 11:75283660-75283682 TCCTCCCAGGGGCCAGGCCATGG - Intronic
1086229938 11:84556187-84556209 GCCTGATAGGAGACAGGACATGG + Intronic
1087179133 11:95124739-95124761 GGTTGTCAGGTGCAAGGCCATGG + Intronic
1089559215 11:119335226-119335248 GAAGGCCAGGAGCCAGGCCAGGG - Exonic
1089644888 11:119872396-119872418 GGCAGGAAGGAGCCAGGCCATGG - Intergenic
1089748045 11:120630597-120630619 CCCTCTCAGGAGCCAGGTAAGGG + Intronic
1090242264 11:125192495-125192517 GCCTGGCAGGAGCTAGGTCTGGG + Intronic
1090587467 11:128229501-128229523 GGATGGCAGGAGCCAGGCCATGG - Intergenic
1090657953 11:128860114-128860136 ACCGGGCAGGAGCCAGGCCTCGG + Intronic
1091629828 12:2151543-2151565 ACATTTCAGTAGCCAGGCCAAGG + Intronic
1092068204 12:5610672-5610694 GCATGTCAGGAACCTGGCAAGGG + Intronic
1092088842 12:5787364-5787386 GCTTGTGGGGAGCCAGGTCACGG - Intronic
1092161370 12:6317174-6317196 GACTGTCAGGAGCTGGGCTAAGG + Intronic
1095089153 12:38087942-38087964 GCCTGAGAGCAGACAGGCCAGGG - Intergenic
1095703778 12:45216607-45216629 GCCCGTCAGGAGCCTGTCCTCGG - Intronic
1099914688 12:88877525-88877547 GCCTGTCAGGAGGCAGGAGGAGG + Intergenic
1100397078 12:94194829-94194851 GCCTACCAGGAGCCAGGCACTGG - Intronic
1103354917 12:120312546-120312568 CACCATCAGGAGCCAGGCCATGG - Exonic
1103610801 12:122123122-122123144 GCCCATCAGGAGCCTGCCCAGGG + Intronic
1104716783 12:131020787-131020809 GGCTCTCAGGGGCCAGGCCCGGG + Intronic
1105464957 13:20631242-20631264 TCCTGACAAGTGCCAGGCCAGGG + Intronic
1106376331 13:29191700-29191722 GGCTGTCATGAGCCAGGGAATGG - Intronic
1108228942 13:48318121-48318143 GGGCGTCAGGAGCCAGGACACGG - Intronic
1109404950 13:61886030-61886052 TCCTGTCCGGAGCTAGCCCAGGG - Intergenic
1113368841 13:109704651-109704673 GCCTGTCGGGTGCCACACCATGG - Intergenic
1113768423 13:112894549-112894571 GCCTGTCCCCAGCCAGGCTAAGG - Intronic
1113964312 13:114144127-114144149 GCCAGTCACAAGCGAGGCCAAGG - Intergenic
1118747370 14:68784162-68784184 GACTCTGAGGAGCCAGGGCAGGG - Intergenic
1119709686 14:76812723-76812745 GACAGACAGGAGCCCGGCCAGGG - Intronic
1121086068 14:91146963-91146985 GCCTGTCAGCTGCACGGCCAGGG + Intronic
1121528940 14:94639148-94639170 GCTTGTCACCAGCCTGGCCATGG + Intergenic
1122703447 14:103605603-103605625 GCCTGTCACATGCCAGCCCATGG - Intronic
1122759550 14:104012300-104012322 ACCTTTCAGGAGCTGGGCCAGGG + Intronic
1122935926 14:104956219-104956241 GCCAGTCAGCACCCAGGCCATGG - Intronic
1122937738 14:104967726-104967748 GGCTGGCAGGAGCCTGGCCCAGG + Intronic
1122967846 14:105139555-105139577 GCCTGGCTGGTGCCTGGCCATGG - Intergenic
1123056045 14:105571340-105571362 GCCTTTCCTGAGCCAGGCCTTGG - Intergenic
1123057339 14:105577603-105577625 GCCTTTCCTGAGCCAGGCCTTGG + Intergenic
1123058523 14:105583917-105583939 GGCTCCCATGAGCCAGGCCAGGG - Intergenic
1123082856 14:105704150-105704172 GGCTCCCATGAGCCAGGCCAGGG - Intergenic
1123671501 15:22664278-22664300 GCCTGTCAGGGGACAGTCCCAGG - Intergenic
1123977999 15:25570778-25570800 GCCTGTCAAGATCCACCCCAAGG + Intergenic
1124323540 15:28737502-28737524 GCCTGTCAGGGGACAGTCCCAGG - Intronic
1124400683 15:29345301-29345323 GCCTTTCAGGAGTAATGCCAGGG + Intronic
1124527430 15:30470698-30470720 GCCTGTCAGGGGACAGTCCCAGG - Intergenic
1124572435 15:30877207-30877229 ACCTTCCAGGAGCCAGGCAAGGG - Intergenic
1124710920 15:32010110-32010132 GCCTGTGGGGAGTGAGGCCAAGG + Intergenic
1124771222 15:32536985-32537007 GCCTGTCAGGGGACAGTCCCAGG + Intergenic
1126858661 15:52862837-52862859 GCCAGTCAAGAGCCAGGCCCTGG - Intergenic
1127828283 15:62725792-62725814 GCCAGTTAGGAGCCAAACCACGG + Intronic
1127917242 15:63464840-63464862 GGCTGGGAGGAGGCAGGCCATGG + Intergenic
1128264439 15:66254287-66254309 GCCTGTTAGGAGCACGGCCTGGG - Intergenic
1128636854 15:69308067-69308089 GCCAGTCAAGGGCCAGGGCAAGG + Intronic
1128740848 15:70082797-70082819 GACAGTGAGGAGCCAGGGCAGGG + Intronic
1129540335 15:76342817-76342839 GCTCGGCAGGCGCCAGGCCAAGG - Intergenic
1129604656 15:77018981-77019003 GTGTGTCAGCAGCCAGCCCATGG - Intronic
1129624492 15:77182499-77182521 GCATGTTGGGAGGCAGGCCAAGG + Intronic
1129760686 15:78127684-78127706 AGCTGTCAGGAGCCGAGCCATGG + Intronic
1129779575 15:78261541-78261563 GCCTGTCAGGAACCAAGCAGTGG + Intergenic
1129871577 15:78944931-78944953 GACTCCCAGGAGCCAGGCCCCGG + Exonic
1131131617 15:89904042-89904064 GCCTCTCAGGAGCCAGGTGAGGG + Intronic
1131222538 15:90597107-90597129 GCCTGTGTGGGGCTAGGCCAGGG - Intronic
1131223953 15:90608332-90608354 GGCAGACAGGAGCCAGGCCTTGG - Intronic
1132232150 15:100192341-100192363 ACCTGTCTGGAGCCTGTCCAAGG + Intronic
1132835439 16:1950668-1950690 GCCTTTCAGCAGCCATGCCTGGG + Intronic
1133018554 16:2955881-2955903 GCCTTCCAGGAACCAGGTCATGG + Intergenic
1133391275 16:5412183-5412205 GCAAGTCAGGAGCCTGGCCAGGG - Intergenic
1138027300 16:53532113-53532135 GCATGTCAAGAGCTAGGCTAGGG - Intergenic
1138251193 16:55503066-55503088 TACTGCCTGGAGCCAGGCCAAGG - Intronic
1138377124 16:56571950-56571972 ACCTGTTAGGAACCAGGCCGCGG - Intergenic
1138543187 16:57700806-57700828 GCCTGTGAGGAACCAGGGGAGGG - Intronic
1139505935 16:67398126-67398148 GCCAGTGAGGAGACAGGGCAAGG - Intronic
1139594568 16:67950276-67950298 GCCTGGGAGCAGCCAGGCCATGG + Intronic
1139741446 16:69038616-69038638 GCCTACCAGGAGCCAGGCAAGGG + Intronic
1139773544 16:69298402-69298424 GCCTTTCAGGAGCCGTGACATGG - Intronic
1139795594 16:69480910-69480932 ACCTGTCAGGAGCCTGGGGATGG - Intergenic
1140411083 16:74740801-74740823 CCCTGGCAGGTGCCAGGCAAAGG + Intronic
1141024216 16:80528731-80528753 TCCTGTAAGGAGCCTGGACATGG - Intergenic
1141097360 16:81172324-81172346 TCCTGTCTTGGGCCAGGCCACGG + Intergenic
1142489171 17:266820-266842 GCCTCACAGGAGCCAGTCCCCGG - Intronic
1142742247 17:1937928-1937950 CCCTGGCTGGAGCAAGGCCAGGG + Intronic
1142743965 17:1945917-1945939 GCCTGCTAGGAGCCAGGCCCTGG - Intronic
1143027054 17:3947147-3947169 GACTGTCAGCAACCTGGCCAGGG + Intronic
1144655258 17:17031079-17031101 GTTTCCCAGGAGCCAGGCCAAGG + Intergenic
1144798028 17:17905726-17905748 GCCTGACTGGGGGCAGGCCAAGG - Intronic
1145159141 17:20562849-20562871 GTTTCCCAGGAGCCAGGCCAGGG - Intergenic
1145295888 17:21592619-21592641 GCCTTTCAGGAGACAGGCTCGGG - Intergenic
1145367897 17:22279443-22279465 GCCTTTCAGGAGACAGGCGCGGG + Intergenic
1147964837 17:44189028-44189050 CCCTGCCAGCAGCCAGGCCATGG + Exonic
1148338908 17:46861515-46861537 TCCTGACAGAAGCCAGGCCATGG - Intronic
1148441192 17:47712405-47712427 GCTTGTCAGGAACCAGGCTGGGG + Intergenic
1148587347 17:48790480-48790502 GGCATTCAGGAGCCTGGCCAGGG + Intronic
1148698242 17:49573918-49573940 CCGTGCCAGGCGCCAGGCCAGGG - Intergenic
1148763932 17:50026654-50026676 GCCTGGCAAGAGTCAGGCCCTGG - Intergenic
1148854981 17:50574076-50574098 CCCTGTGAGGTGCCAGGGCAGGG + Intronic
1149242336 17:54664562-54664584 GCCTGTCAGGAGTCATGGAATGG - Intergenic
1149638194 17:58186706-58186728 GCCTGTAGGGAGCCTGGCCCAGG + Intergenic
1151464220 17:74274220-74274242 GCGCGTCCGGAGCCAGGCCGGGG + Intergenic
1151747548 17:76019400-76019422 CCCTGCCAGCACCCAGGCCAGGG + Intronic
1152462839 17:80450316-80450338 GGCTGGCGGGGGCCAGGCCAGGG + Intergenic
1153528039 18:6016082-6016104 GCATGTCAGGAGACAGAGCAAGG + Intronic
1153769586 18:8404783-8404805 ACCTGGCAGGAGCCCGGCCCTGG - Intronic
1154176212 18:12088300-12088322 GGCAGTTAGGAGCCAGGGCAGGG - Intergenic
1154347484 18:13554808-13554830 GCATGTCAGGAGCCAGGGTTAGG - Intronic
1155999687 18:32371202-32371224 CACTGGCAGGACCCAGGCCAGGG + Intronic
1156518201 18:37698831-37698853 GCCTCTCAGGAGCCAGGGTCAGG + Intergenic
1156561114 18:38126849-38126871 GCATGACAGGAACCAGGTCAAGG + Intergenic
1157332114 18:46711759-46711781 AGCTGTCAGGAGACATGCCATGG + Intronic
1157617467 18:48995629-48995651 GCCCGCCTGGAGCCAGGCCGGGG + Intergenic
1157801186 18:50622545-50622567 GCCTCCCAGCAGCCAGGGCAAGG + Intronic
1157803074 18:50636552-50636574 GGCTGTCAGGAGTCACCCCATGG - Intronic
1158655217 18:59324687-59324709 GGCTTCCAGGAGCCAGTCCATGG - Intergenic
1160975679 19:1791174-1791196 GTCGGCCAGGAGCCAGCCCAGGG - Intronic
1161252867 19:3290412-3290434 CCCTGTCAGGGGGCAGGCGAGGG - Intronic
1161301420 19:3544698-3544720 GGCTGTCAGGAGTCAGGGCCGGG + Exonic
1161323614 19:3652543-3652565 GCCTGTCAGGAGCAGAGCCTGGG - Intronic
1161954896 19:7488258-7488280 GCATGGCAGGGCCCAGGCCATGG + Intronic
1162301131 19:9845877-9845899 GCGTCTGAGGAGCCAGGCCCAGG - Intronic
1162585009 19:11553172-11553194 CCCTGTCAGGGCCCAGCCCAGGG + Exonic
1163035431 19:14566592-14566614 TCCTGCCAGGGGCCAGGCCTGGG + Intronic
1163358649 19:16831015-16831037 GCCAGTCAGGAGATAGGTCATGG + Intronic
1163692528 19:18745374-18745396 GCCTGCCAAGAGACAGCCCAGGG - Intronic
1163822932 19:19506448-19506470 ACCTCCCAGGAGCAAGGCCAGGG - Exonic
1164455567 19:28403950-28403972 GCCAGGCAGGAGGCAGCCCAGGG - Intergenic
1164501794 19:28826629-28826651 GGCTGTCTGGAGCCAAGCCCTGG - Intergenic
1164806530 19:31121289-31121311 GACTGACAGGAGACATGCCAGGG - Intergenic
1165060869 19:33204676-33204698 GCCCAGCAGGAGCCAGTCCAGGG - Exonic
1165108725 19:33489023-33489045 GCCAGTCACCAGCCAGTCCAGGG + Intronic
1165493211 19:36137289-36137311 GCCTTGCTGGGGCCAGGCCAAGG - Intergenic
1165826447 19:38708603-38708625 GCCTGTATGGATCCAGGCCCTGG + Intronic
1166079227 19:40433552-40433574 GCCTGTCAGGAGACAAGGCCAGG + Intergenic
1167454311 19:49590588-49590610 GCCCGTGAGGGGCCAGGACACGG - Exonic
1167990747 19:53358441-53358463 GCAGGACAGGAGCCAGGCCTGGG - Intergenic
1168645818 19:58058698-58058720 GCCTGCCAGGCGCTAGGCCTAGG - Intergenic
925406248 2:3606991-3607013 GACTGTGAGGAGACAGGCCGCGG - Intronic
925737522 2:6977271-6977293 GGCTGGCAGGAGGCAGGCCCAGG + Intronic
926323209 2:11763257-11763279 GCCTGCCATGACCCAGTCCAGGG + Intronic
926969642 2:18453714-18453736 GCCTGCTAGGAGACAGCCCAGGG + Intergenic
927142110 2:20137538-20137560 GCCAGTTAGGAGTCAGGCCCTGG - Intergenic
927497659 2:23561654-23561676 GCCTGTGAGGCGGCAGGGCATGG - Intronic
927890076 2:26742625-26742647 GCCTGACAGCAGCCTGGCCCCGG - Intergenic
927930079 2:27038303-27038325 GCCTGAAAGGTGTCAGGCCATGG - Intronic
932301513 2:70670760-70670782 GCCTGTGAGCAGCCTGGCCAAGG + Intronic
933763934 2:85694651-85694673 GCCTGTCACTGGCCTGGCCAAGG + Intronic
933947606 2:87300191-87300213 GCTTGTCAGGGGCCAGGGAATGG - Intergenic
933982641 2:87565573-87565595 CCCTGTCAGGAGACAGAACAAGG - Intergenic
934752113 2:96800025-96800047 TGGGGTCAGGAGCCAGGCCAGGG + Intronic
936145557 2:109978419-109978441 GGCTGCCAGGAGCCAGTCTATGG + Intergenic
936172057 2:110185397-110185419 CCCTGTCAGGAGCCAGTTAATGG - Intronic
936199129 2:110393059-110393081 GGCTGCCAGGAGCCAGTCTATGG - Intergenic
936239339 2:110773565-110773587 GTCGGTCAGGAGCCAGTCCTGGG - Intronic
936311199 2:111385220-111385242 CCCTGTCAGGAGACAGAACAAGG + Intergenic
936332590 2:111561386-111561408 GCTTGTCAGGGGCCAGGGAATGG + Intergenic
936968629 2:118152368-118152390 GACAGCCAGGAGTCAGGCCAAGG + Intergenic
937009904 2:118553076-118553098 GCATGGCAGAAGCCAGGCCAAGG - Intergenic
937337183 2:121069221-121069243 GCCAGCCAGCAGCCAGGCCCAGG + Intergenic
939420053 2:141955587-141955609 GCCAGTGAGCAGCCAGGACAAGG - Intronic
941001582 2:160208193-160208215 GCTGGTCAGGAGCCAGGGCCTGG + Intronic
942001470 2:171652507-171652529 AGCTGTCTGGAGCCAGGGCAGGG + Intergenic
944083515 2:195817453-195817475 GCCTGCCAGAAGTCAGGGCAGGG - Intronic
944640057 2:201715741-201715763 GGCTGTGAGGGCCCAGGCCAAGG - Exonic
944963302 2:204901223-204901245 ACCAGTCAGGAGCCAGGGCCTGG + Intronic
946072965 2:217050185-217050207 GCCTGGGAGGACCCTGGCCAGGG - Intergenic
946410803 2:219514256-219514278 GGGCGTCAGGAGCCAGGCCAGGG - Intronic
948164116 2:235848185-235848207 CACTGTGAGGAGCCAGGCAAGGG - Intronic
948889319 2:240899212-240899234 GCGTGCCAGGAGCCCTGCCAGGG + Intergenic
1168809705 20:697019-697041 ACCTGTCAGGAGTCAGGAGAGGG - Intergenic
1170572982 20:17642780-17642802 CCATCTCAGGAGCCAGGCCATGG + Intronic
1170573926 20:17648463-17648485 TCCTGACAGGAAGCAGGCCAAGG + Intronic
1172393670 20:34583785-34583807 TTCTGTCAGAAGCCAGGCCAAGG + Intronic
1172669899 20:36627735-36627757 GCCTGACTAGAGCCTGGCCATGG + Intronic
1173206332 20:40997365-40997387 GCCTGTTAGGAATCAGGCCGAGG + Intergenic
1173414182 20:42841016-42841038 GGCTGTCAGTAGCCTTGCCAAGG - Intronic
1173564264 20:44027961-44027983 GCCTGACAGGTGCCAGACCTCGG + Intronic
1174616498 20:51839493-51839515 ACCTGCCAGGAGCCAGGTCGAGG + Intergenic
1175212904 20:57372733-57372755 GCCTGGCAGGACCCAGGCAGGGG - Intronic
1175305680 20:57974050-57974072 GCCTGGCAGGAGCCAGCACCTGG - Intergenic
1175978054 20:62723434-62723456 GCTGGTCAGGAGCCAGGGCAAGG + Intronic
1178355574 21:31908402-31908424 GCCTGTAAGGAGGCTGGCCAGGG + Intronic
1178426862 21:32485552-32485574 GCCCATGAGGAGCCAGGACAAGG - Intronic
1178639241 21:34332934-34332956 CCCTCTCAGAAGCCAGGCCTGGG + Intergenic
1179028739 21:37701822-37701844 AGCAGGCAGGAGCCAGGCCAGGG + Intronic
1179553930 21:42160537-42160559 GCGTGTCCGGTGCCAGGCCAGGG + Intergenic
1180000531 21:44993485-44993507 GCCTGCCAGGAGCCGGGTCCTGG - Intergenic
1180722477 22:17919802-17919824 GCCTGTCAGGAGCCAGGACCTGG + Intronic
1180844564 22:18974055-18974077 GCCTGGCTGCACCCAGGCCAAGG + Intergenic
1181323829 22:22029677-22029699 GCCTGGGAGCATCCAGGCCAAGG + Intergenic
1181407663 22:22696264-22696286 GCCTGTCTGGATCCCAGCCAGGG + Intergenic
1181426933 22:22849798-22849820 ACCTTCCAGGAGCCTGGCCATGG - Intronic
1181549758 22:23630961-23630983 GCCTGTCAGGGGGCAGGGGAAGG + Intronic
1181769176 22:25113089-25113111 GCCTAGCAGGACACAGGCCAAGG - Intronic
1181807543 22:25384182-25384204 GCTTGTCAGAAGCCAGTCGAGGG + Intronic
1182049343 22:27300967-27300989 TACTGTCTGGAGCCAGGCTAGGG - Intergenic
1182066546 22:27435337-27435359 GCCTGTCTGAGGCCAGGCCGGGG + Intergenic
1183739941 22:39663863-39663885 GCAGGGCAGGCGCCAGGCCAAGG + Intronic
1183971759 22:41482706-41482728 GCCTGTCATGTGCCAGGCACTGG + Intronic
1184567330 22:45299917-45299939 GGCTGTCAGGAGACAGAGCAGGG - Intergenic
1184811347 22:46834656-46834678 GACTGTCAGTAGTCAGGGCATGG + Intronic
1184924762 22:47629477-47629499 GCCTCTCTGCAGCCCGGCCACGG + Intergenic
949194508 3:1289284-1289306 GACTGGGAGGAGCCAGCCCATGG + Intronic
949505549 3:4724440-4724462 GGCTGTCAGGTGGCAGGCCAGGG - Intronic
950118805 3:10468254-10468276 GGCTGACAGGTGCGAGGCCAGGG + Intronic
950361178 3:12450509-12450531 GCCTGACAGGAGCCTGACCATGG + Intergenic
952751944 3:36831752-36831774 GCCTCTCGGGAACCTGGCCAGGG + Exonic
953666120 3:44927785-44927807 GCCTGGCAGAAGCCTGGCCAGGG + Intronic
953820770 3:46205798-46205820 GCCTGGCAAGAGCCAGGCCAGGG + Intronic
953976466 3:47385345-47385367 GCCTGTCATGTGCCAGCCCTGGG + Intronic
954333524 3:49903330-49903352 GTCTGTCCAGAGCCTGGCCACGG - Exonic
954447880 3:50556364-50556386 GTCTGCCTGGAGCCAGGCAATGG + Intergenic
954534093 3:51345070-51345092 GCCTGCCAAGAGCCAATCCATGG - Intronic
955919566 3:63941285-63941307 GCCTGTTAGCAGTCAGGCTATGG + Intronic
957951613 3:87134897-87134919 GACTGTCAGGACCCAGGTGAGGG - Intergenic
959350558 3:105256576-105256598 GCCAGGCAGGATGCAGGCCAGGG + Intergenic
960442333 3:117704147-117704169 GCCTGATAGGGGCCAGGACACGG - Intergenic
961361936 3:126373474-126373496 ACATGTCACTAGCCAGGCCAGGG + Intergenic
961557304 3:127705213-127705235 GCCTGTCAGGAGGAGGGGCACGG + Intronic
964757947 3:160105696-160105718 TCCTGTCAGGACCCATTCCAAGG - Intergenic
964965418 3:162486570-162486592 GGCTGTCAGGAGGCATGCCAGGG - Intergenic
965866964 3:173216431-173216453 GCCCGCCAGGAGCCAGGGCCTGG + Intergenic
965984744 3:174737085-174737107 GCCTGGCAGGAGCCAGGAACAGG - Intronic
966091548 3:176144307-176144329 GCCTATGAGGGGCCAGGCCTTGG + Intergenic
967080480 3:186045108-186045130 CCCTTTCATGAGCCAAGCCAGGG - Intergenic
967975758 3:195034017-195034039 GCCCGTCTGAAGACAGGCCAAGG - Intergenic
968020761 3:195386634-195386656 GCCTGTCAGGTGCGGGGCAAGGG + Intronic
968531984 4:1096967-1096989 GCCTCTCAGGGGCCCTGCCAGGG + Intronic
968817692 4:2830193-2830215 GCCCGTCAGAGGCCAGGCCAGGG - Intronic
969638884 4:8385045-8385067 ACCTGGCAGGGGCCAGGCCATGG - Intronic
971954356 4:33396468-33396490 GCCATTCAGGAGCCAGGACCTGG - Intergenic
972539985 4:40030874-40030896 GCATGTCAGGAGTCCGGCCTGGG + Intergenic
977571642 4:98635223-98635245 GCCTTCCAGAAGCCAGGCCCTGG + Intronic
978491183 4:109313789-109313811 CCCATTCAGGTGCCAGGCCAAGG + Intergenic
978782884 4:112575706-112575728 GCAAGGCAGGAGCTAGGCCAGGG + Intronic
982899744 4:160983185-160983207 GCCTGTTAGGAGCCAACCCACGG + Intergenic
985230355 4:187809592-187809614 GCCGGTCAGGAGCCAGGCCTTGG + Intergenic
986744482 5:10731577-10731599 GCCGGGCAGAAGCCAGGCTAGGG - Intronic
987133838 5:14882823-14882845 CCCTGTGAGCAGCCTGGCCATGG - Intergenic
988376250 5:30439500-30439522 GCCTCCCAGGAGCCAAGCCCTGG - Intergenic
993618366 5:90139100-90139122 GTCTGTAGGGAGCCAGGCCTTGG - Intergenic
994725332 5:103428518-103428540 GCCTTTCTGGACCCTGGCCATGG - Intergenic
995847917 5:116513779-116513801 GCCTGTCAGAGGGCAGGGCATGG - Intronic
998262456 5:140641890-140641912 GCTGGTCAGGAGCCCGACCAGGG - Exonic
999651745 5:153774791-153774813 ACTTGGCAGAAGCCAGGCCATGG + Intronic
1001453682 5:171845242-171845264 GGCAGTGGGGAGCCAGGCCAGGG - Intergenic
1002094722 5:176824091-176824113 GCCAGTCAGGATCCTTGCCAGGG + Intronic
1002279481 5:178122168-178122190 CCTTGGCAGGAGCCAGGACAAGG + Exonic
1003017591 6:2480579-2480601 GCCTGTATGGAACCAGGCCAAGG - Intergenic
1007234052 6:40378020-40378042 TCCTCTCAGAAGCCAGGCCATGG + Intergenic
1007483020 6:42162579-42162601 GCCACACAGGAGCCAGGCCAAGG + Intronic
1007965677 6:46001609-46001631 GCCTACCAGGTGCCAGGCCCTGG - Intronic
1010745137 6:79552143-79552165 ACCTGGCAGGAGCCAGTCCATGG + Intergenic
1017038684 6:150289978-150290000 TCATGACAGGAGCCAGCCCAGGG - Intergenic
1018443727 6:163835905-163835927 GCATGCCAGGCGCCAGGCAAAGG - Intergenic
1018608676 6:165625248-165625270 ACCAGCAAGGAGCCAGGCCAAGG + Intronic
1018610666 6:165644843-165644865 GACGGTCATGAGCAAGGCCAGGG + Intronic
1018669982 6:166169372-166169394 GGCTGCCAGGAGCCAGTCCCGGG + Intergenic
1018804429 6:167248041-167248063 GCCTGGCAGGAGCCAGGATGTGG + Intergenic
1019120516 6:169800377-169800399 GCCTGGCAGGAGCCAAGACAAGG + Intergenic
1019129924 6:169865996-169866018 GCCTCTGAGGCCCCAGGCCAGGG + Intergenic
1019285757 7:222139-222161 GCAAGTCAGGAGACAGGGCAGGG + Intronic
1019520773 7:1459663-1459685 GCCTATCAGGAGGCAGGACCCGG - Intergenic
1019694630 7:2438359-2438381 GCCTGTATGGAGGCAGCCCAGGG + Intergenic
1020041947 7:5010850-5010872 CCCTGTTAGGACCTAGGCCAAGG + Intronic
1022669301 7:32440947-32440969 ACATGGCAGGAGCAAGGCCAAGG + Intergenic
1025871226 7:65436062-65436084 GCCAGTCAGGGTCCAGGTCATGG - Intergenic
1026930907 7:74222497-74222519 TCCAGGCAGGAGCCAGGTCATGG - Intronic
1026973265 7:74480609-74480631 GCCTGCCAGGAGCCAGGCTCAGG + Intronic
1028477173 7:91265103-91265125 GCGGGCCAGGGGCCAGGCCAGGG + Exonic
1029207464 7:98878326-98878348 TCCTCCCAGGAGCCAGGCCTCGG - Intronic
1029226657 7:99033683-99033705 GCCTGTCTGGAGCAGGCCCATGG - Intronic
1029436255 7:100565555-100565577 GCTTGACAGGAGCCGGGCCCGGG - Exonic
1029734718 7:102459264-102459286 GCGTGTGAGGAGACAGGACACGG + Intronic
1032002513 7:128274639-128274661 GCCTTTCATGTGCCAGGCCTGGG + Intergenic
1034410258 7:150937441-150937463 GGCTGCCAGGAGCCAGGTCCTGG + Intergenic
1034460744 7:151196671-151196693 ACAGGTCAGGAGCCAGGCCCTGG + Intronic
1034930378 7:155156934-155156956 GTCCGTCAGCAGCCAGGACAGGG + Intergenic
1034959450 7:155355905-155355927 GCCTGTCAGGAGGAGGGGCAAGG - Intergenic
1035079144 7:156201855-156201877 GGGTGTCAGGAGCCAGTCCAAGG + Intergenic
1035272422 7:157728244-157728266 GCCTGTCAGGAGGCTGTACAAGG - Intronic
1036673201 8:10806786-10806808 TCCTGACAGGAGGGAGGCCAGGG + Intronic
1037120969 8:15286625-15286647 GCCTGTCAGGGGGCAGGGGAAGG - Intergenic
1037808154 8:22069753-22069775 CCCTGTCAAGAGCCAAGACAGGG - Intronic
1038075800 8:24072308-24072330 GCCTGTCAGGATCACGCCCAAGG - Intergenic
1038644918 8:29352948-29352970 GCCTCTCAGGAGGCAGGTCCGGG + Intergenic
1040792567 8:51250038-51250060 GCCTGTTGGGGGGCAGGCCAAGG + Intergenic
1041982094 8:63873719-63873741 GCCTCCCAGGACCCAGGGCAGGG + Intergenic
1042206123 8:66331609-66331631 GCCTATCAGGAGCCAAGCCCTGG - Intergenic
1042484277 8:69333867-69333889 GCCTGAGAGCAGCGAGGCCAGGG - Intergenic
1045338798 8:101233460-101233482 AGCTGGCAGGAACCAGGCCAAGG + Intergenic
1045414631 8:101953620-101953642 GCCTGTCATGAGCAAGGCTCTGG - Intronic
1045476782 8:102559724-102559746 GCCTGGGCAGAGCCAGGCCAGGG + Intronic
1045930514 8:107620457-107620479 ACCTGGCAGGAGCAAGGGCAAGG - Intergenic
1046115631 8:109779945-109779967 GGCCTTCAGGAGCCAGGCCTTGG + Intergenic
1049025763 8:139987850-139987872 GCTGGTCAGGAGCGAGGCCAGGG - Intronic
1049216946 8:141412601-141412623 GCCTGGATGGAGCCAGGCCTTGG - Intronic
1049252456 8:141596613-141596635 GCCTGTCTGGAGCCCAACCAAGG - Intergenic
1049417775 8:142503377-142503399 GCCTGGCACAGGCCAGGCCAGGG + Intronic
1051542327 9:18233837-18233859 GCCTCTCATGAGCCACCCCAGGG - Intergenic
1051629364 9:19127715-19127737 GCCTGTCGGGAGCCGGGCGGGGG + Intronic
1056201358 9:84279985-84280007 GGCTGTCATGAAGCAGGCCACGG + Exonic
1056792602 9:89635769-89635791 GCATTTCAGGGTCCAGGCCATGG + Intergenic
1057139655 9:92718804-92718826 GGCAGTGAGGAGCCAGGCGAGGG + Exonic
1057391204 9:94642783-94642805 GCCAGTAAGTGGCCAGGCCAGGG - Intergenic
1059573243 9:115463005-115463027 GGCAGTCAGGAGCCAGACCATGG + Intergenic
1062136232 9:134929819-134929841 GCCTGCCAGGAGCTGGTCCAAGG - Intergenic
1062161574 9:135083306-135083328 GCCTGGCCACAGCCAGGCCAAGG - Intronic
1062389712 9:136329121-136329143 GCCAGGCAGGAGCCAGCCCCTGG + Intronic
1062462996 9:136669636-136669658 GCCTGGCAGGGGCCAGCCCAGGG - Exonic
1185926275 X:4150478-4150500 GCCTGTCTGCAGCCAGGAAAGGG - Intergenic
1187477813 X:19627326-19627348 GCTTGGCAGGAGCTATGCCAGGG - Intronic
1190885912 X:54530775-54530797 GGCTGTCTAGAGCCAAGCCAAGG - Intronic
1191252107 X:58264667-58264689 TCCTGTGAGGACCCAGGCCTAGG - Intergenic
1192631017 X:72777788-72777810 GCCTGTCAGGCCCCAAACCAGGG - Intronic
1192650692 X:72943013-72943035 GCCTGTCAGGCCCCAAACCAGGG + Intronic
1193441107 X:81539820-81539842 GCCATACAGGAGCCAGGGCATGG - Intergenic
1195108111 X:101619578-101619600 CCCTTTCAGGAGGCAAGCCAGGG + Intergenic
1195971438 X:110477885-110477907 GCATCTCAGGACCCAGGCCTGGG - Intergenic
1197902333 X:131387869-131387891 GCCTGCCAGGGGCTAGGGCAGGG - Intronic
1198161915 X:134016508-134016530 GCCAGTCAGGGTCCAGGTCATGG + Intergenic
1200958451 Y:8973599-8973621 GTCAGTCAGGAGGCAGGGCATGG - Intergenic