ID: 1070605967

View in Genome Browser
Species Human (GRCh38)
Location 10:77898731-77898753
Sequence GCACAGGCCTGTCAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605967_1070605974 2 Left 1070605967 10:77898731-77898753 CCTGGCTCCTGACAGGCCTGTGC No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605967_1070605976 7 Left 1070605967 10:77898731-77898753 CCTGGCTCCTGACAGGCCTGTGC No data
Right 1070605976 10:77898761-77898783 AGAGGGCCAGGCAGGCGGTAAGG No data
1070605967_1070605973 -1 Left 1070605967 10:77898731-77898753 CCTGGCTCCTGACAGGCCTGTGC No data
Right 1070605973 10:77898753-77898775 CATGCCTGAGAGGGCCAGGCAGG No data
1070605967_1070605972 -5 Left 1070605967 10:77898731-77898753 CCTGGCTCCTGACAGGCCTGTGC No data
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605967_1070605970 -10 Left 1070605967 10:77898731-77898753 CCTGGCTCCTGACAGGCCTGTGC No data
Right 1070605970 10:77898744-77898766 AGGCCTGTGCATGCCTGAGAGGG No data
1070605967_1070605978 16 Left 1070605967 10:77898731-77898753 CCTGGCTCCTGACAGGCCTGTGC No data
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605967 Original CRISPR GCACAGGCCTGTCAGGAGCC AGG (reversed) Intronic
No off target data available for this crispr