ID: 1070605968

View in Genome Browser
Species Human (GRCh38)
Location 10:77898738-77898760
Sequence CAGGCATGCACAGGCCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 984
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 927}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605968_1070605979 29 Left 1070605968 10:77898738-77898760 CCTGACAGGCCTGTGCATGCCTG 0: 1
1: 0
2: 3
3: 53
4: 927
Right 1070605979 10:77898790-77898812 AGGAAGCTCCGTGCTGTGCAAGG No data
1070605968_1070605976 0 Left 1070605968 10:77898738-77898760 CCTGACAGGCCTGTGCATGCCTG 0: 1
1: 0
2: 3
3: 53
4: 927
Right 1070605976 10:77898761-77898783 AGAGGGCCAGGCAGGCGGTAAGG No data
1070605968_1070605974 -5 Left 1070605968 10:77898738-77898760 CCTGACAGGCCTGTGCATGCCTG 0: 1
1: 0
2: 3
3: 53
4: 927
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605968_1070605978 9 Left 1070605968 10:77898738-77898760 CCTGACAGGCCTGTGCATGCCTG 0: 1
1: 0
2: 3
3: 53
4: 927
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605968_1070605973 -8 Left 1070605968 10:77898738-77898760 CCTGACAGGCCTGTGCATGCCTG 0: 1
1: 0
2: 3
3: 53
4: 927
Right 1070605973 10:77898753-77898775 CATGCCTGAGAGGGCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605968 Original CRISPR CAGGCATGCACAGGCCTGTC AGG (reversed) Intronic
900074716 1:804083-804105 CAGAGATGCACAGACCTGTGAGG + Intergenic
900496532 1:2978456-2978478 CAGGCAGTCACAGTCCTGTGAGG - Intergenic
901308326 1:8249766-8249788 CAGGCCTTCACAGGACTGTGGGG + Intergenic
901319962 1:8333849-8333871 CAGGCATGCGCAGGCCTCACAGG + Intronic
901502530 1:9662013-9662035 CAGGCATGCACCACCATGTCCGG - Intronic
901563209 1:10089840-10089862 CAGGCGTGCACCAGCATGTCTGG + Intronic
902033883 1:13442422-13442444 CAGGCATAGAAGGGCCTGTCTGG + Intergenic
902161847 1:14536737-14536759 CAGGCATGCACCACCATGTCTGG - Intergenic
902233982 1:15046153-15046175 CAGGCATCCACCGCCATGTCTGG - Intronic
902426373 1:16326196-16326218 CAGGCATGCACCAGCATGCCCGG + Intronic
902777057 1:18681880-18681902 CAGGCATGCACCAACATGTCTGG + Intronic
902840937 1:19073497-19073519 CATGCATGCTCTGGCCTGCCAGG + Intergenic
902851193 1:19158598-19158620 CAGGCATGCACCACCATGTCTGG + Intronic
903150305 1:21403335-21403357 CAGGCATGCACAACCATGCCTGG + Intergenic
903207904 1:21796572-21796594 CAGGCATGCACCACCATGTCCGG - Intergenic
903370207 1:22830378-22830400 GATTCAAGCACAGGCCTGTCTGG - Intronic
903380079 1:22890515-22890537 CAGGCATGCACATCTTTGTCTGG + Intronic
903591334 1:24458091-24458113 CAGGCATTCACGGCCCTGGCTGG + Intronic
903754744 1:25652896-25652918 CAGGCATGCACCGCCATGCCTGG + Intronic
904245626 1:29185839-29185861 CAGGCATGCACCGCCATGCCTGG - Intergenic
904561763 1:31403090-31403112 CAGGCATGCACCGCCGTGCCTGG - Intergenic
905575475 1:39040682-39040704 CAGGCATGCACCACCCTGCCTGG - Intergenic
905639382 1:39577967-39577989 CAGGCATGCACCCCCATGTCTGG - Intergenic
905754937 1:40501179-40501201 CAGGCATGCACCACCATGTCTGG + Intergenic
905988853 1:42314391-42314413 CAGGCATGCACCACCATGTCTGG + Intronic
905989187 1:42318482-42318504 CAGGCATGCACCACCATGTCTGG + Intronic
906613845 1:47221862-47221884 CAGGCATGCACATGCATGTGTGG + Intronic
906689062 1:47780794-47780816 CAGGCATGAACAGGCCCTTCCGG + Intronic
907018630 1:51042728-51042750 CAGGCATGCACTGCCATGCCTGG - Intergenic
907137334 1:52152130-52152152 CAGGCATGCACCACCATGTCTGG + Intronic
908347513 1:63250474-63250496 CAGGCATGCACCACCATGTCTGG + Intergenic
909462428 1:75932983-75933005 CAGGCATGCACCGCCATGCCTGG + Intergenic
909745359 1:79089185-79089207 CAGGCATGCACCATCATGTCTGG + Intergenic
910593657 1:88954902-88954924 CAGGCATGCACCACCCTGCCTGG + Intronic
910755104 1:90681280-90681302 CAGGCATGCACCACCATGTCTGG - Intergenic
910833050 1:91479546-91479568 CAGGCATGCACTACCATGTCTGG - Intergenic
910893278 1:92040466-92040488 CAGGCATGCACTGCCATGCCTGG + Intronic
911026098 1:93436439-93436461 CAGGCATGCACCACCATGTCTGG + Intergenic
912351534 1:109018670-109018692 CAGGCATGCACAACCATGCCTGG - Intronic
912833886 1:112978249-112978271 CAGGCATGCACCAGCATGCCTGG - Intergenic
913225263 1:116693430-116693452 CAGGCATGAACACTGCTGTCTGG + Intergenic
913420612 1:118663888-118663910 CAGGCATGCACAACTGTGTCTGG - Intergenic
913606371 1:120470297-120470319 CAGGCATGCACAATCATGCCTGG - Intergenic
914259473 1:145986809-145986831 CAGGCATGCACCACCATGTCTGG - Intergenic
914385937 1:147170720-147170742 CAGGCATGCACCAGCATGCCCGG + Intronic
914714548 1:150243461-150243483 CAGGCATGCACAACCATGCCTGG + Intergenic
915697156 1:157754821-157754843 CAGGCATGCACCGCCGTGACTGG - Intronic
915984302 1:160448459-160448481 CAGGCATGCGCTGCCATGTCTGG + Intergenic
915993842 1:160544629-160544651 CAGGCAGGAAGGGGCCTGTCTGG - Intronic
916584350 1:166137318-166137340 CAGGCATGCAAAGGACTGAAAGG + Intronic
918721533 1:187858397-187858419 CAGGCATGCACCACCCTGCCTGG + Intergenic
918965707 1:191344695-191344717 CAGGCATGAACAAGCGTGCCCGG + Intergenic
919028626 1:192209806-192209828 CAGGCATGCACCACCATGTCCGG + Intergenic
919455062 1:197811374-197811396 CAGGCATGCACAACCATGCCTGG - Intergenic
919657537 1:200212855-200212877 TAGGCATGCACCGCCATGTCTGG + Intergenic
919663366 1:200269429-200269451 CAGGCCTTCACAGCCTTGTCTGG + Intergenic
919685312 1:200478868-200478890 CAGGCATGCACCACCATGTCCGG - Intergenic
920040731 1:203094186-203094208 CAGGCATGCACCAGCATGCCTGG - Intronic
920320470 1:205117950-205117972 CAGGCATGCACTGCCATGTCCGG + Intronic
920536593 1:206741351-206741373 CTGGCATGCAAATGCCTGTGGGG + Intergenic
920561625 1:206942827-206942849 CAGGCATGCACAGGCAGGTCGGG + Intronic
920605687 1:207382237-207382259 CAGGCATGCACCGTCATGCCTGG - Intergenic
920620520 1:207541999-207542021 CAGGCATGCACTACCATGTCTGG - Intronic
920622302 1:207560556-207560578 CAGGCATGCACTACCATGTCTGG - Intronic
920623921 1:207577625-207577647 CAGGCATGCACCACCATGTCTGG - Intronic
921144404 1:212339318-212339340 CAGGCATGCACCACCATGTCTGG + Intronic
921273031 1:213489736-213489758 CAGGCATAGAAAGGCATGTCGGG + Intergenic
921734058 1:218606711-218606733 CAGGCATGCACGAGCATGCCTGG + Intergenic
921860523 1:220038223-220038245 CAGGCATGCACAACCATGCCCGG + Intronic
922270561 1:224028988-224029010 CAGAGATGCACAGACCTGTGAGG + Intergenic
922628757 1:227082322-227082344 CAGGCATGCACCAGCATGCCTGG + Intronic
922709796 1:227817817-227817839 AAAGAATGCACAGGCCTTTCTGG - Intronic
923500601 1:234560679-234560701 CAGGCATGCACAGCCATGCCTGG + Intergenic
923559910 1:235031146-235031168 CAGGCATGCACCACCATGTCCGG - Intergenic
923566539 1:235080659-235080681 CAGGCATGCACCACCATGTCTGG - Intergenic
923831687 1:237565407-237565429 CAGGCATGCACTACCATGTCTGG + Intronic
924284923 1:242476210-242476232 CAGGCATGCACCACCATGTCTGG - Intronic
924374215 1:243388729-243388751 CAGGCATGCACAACCATGCCTGG - Intronic
1062957166 10:1547911-1547933 AAGGCCTTCCCAGGCCTGTCAGG - Intronic
1063166726 10:3470199-3470221 CAGGCATGCACAACCATGCCGGG + Intergenic
1063210298 10:3874828-3874850 CAGGCATGCACTGCCATGCCCGG + Intergenic
1063615536 10:7596902-7596924 CAGGCATGCACCGTCATGCCTGG - Intronic
1063680669 10:8184595-8184617 CAGGCATGCACCACCATGTCTGG - Intergenic
1063866262 10:10368461-10368483 CAGGCATGCACCACCCTGCCTGG + Intergenic
1063924707 10:10966439-10966461 CAGGCATGGACAGTCCTGCTTGG + Intergenic
1064054346 10:12084906-12084928 CAGGCATGCACCAGCATGCCTGG - Intronic
1064074015 10:12254613-12254635 CAGGCATGCACCAGCATGTCTGG - Intergenic
1064137979 10:12766828-12766850 CAGGGCTGCGCAGGCCTGGCAGG + Intronic
1064216444 10:13404612-13404634 CAGGCATGCACCGCCATGCCCGG - Intergenic
1064343867 10:14512794-14512816 CAGGCATGCACCACCATGTCTGG - Intergenic
1064846287 10:19658003-19658025 CAGGCATGCACCACCATGTCTGG - Intronic
1065032398 10:21601084-21601106 CAGGCATGCACCATCATGTCTGG + Intronic
1065182944 10:23145140-23145162 CAGGCATGCACCAGCATGCCTGG + Intergenic
1065372525 10:25003347-25003369 CAGGCATGCACCGCCATGCCTGG + Intronic
1065586568 10:27224232-27224254 CAGGCGTGCACCGCCATGTCTGG - Intronic
1065593375 10:27288373-27288395 CAGGCATGCACCACCATGTCTGG + Intergenic
1065656994 10:27961921-27961943 CAGGCATGCACCACCATGTCTGG - Intronic
1065723333 10:28646609-28646631 CAGGCATGCGCAACCATGTCCGG + Intergenic
1065782358 10:29181829-29181851 AAAGCATCCACAGCCCTGTCCGG + Intergenic
1065785119 10:29205574-29205596 CAGGCATGCACTGCCATGCCTGG + Intergenic
1066251517 10:33637542-33637564 CAGGCATGCACAACCATGCCTGG - Intergenic
1066578418 10:36852214-36852236 CAGGCATGCACCACCATGTCTGG + Intergenic
1067054169 10:43041639-43041661 CAGGCATGCAAAGGCCAGTAGGG + Intergenic
1067270706 10:44789235-44789257 CAGGCCTCCTCAGCCCTGTCTGG + Intergenic
1067557976 10:47285560-47285582 CAGCTCTGCACAGGGCTGTCTGG + Intergenic
1067690660 10:48499326-48499348 CAGGCATGGGCAGGCCTCGCTGG + Intronic
1068159119 10:53240983-53241005 CAGGCATACACTACCCTGTCTGG - Intergenic
1068488980 10:57697886-57697908 CAGGCACGCACAACCATGTCCGG - Intergenic
1068488984 10:57697935-57697957 CAGGCATGCACAATCATGCCCGG - Intergenic
1068540033 10:58282102-58282124 CAGGCATGCACAACCATGCCTGG + Intronic
1068867842 10:61913892-61913914 CAGGCATGCACCACCATGTCCGG + Intronic
1068989567 10:63136272-63136294 CAGGCATGCACCACCCTGCCCGG + Intronic
1069563832 10:69450402-69450424 CAGGCATGCACCACCCTGCCCGG + Intergenic
1069966535 10:72122633-72122655 CAGGCATGCACTGTCATGCCTGG - Intronic
1070034044 10:72704678-72704700 CAGGCATGCACTGTCATGCCTGG + Intronic
1070605968 10:77898738-77898760 CAGGCATGCACAGGCCTGTCAGG - Intronic
1070715594 10:78718797-78718819 CAGGTGTGCACAGGCCAGGCAGG + Intergenic
1071111601 10:82164061-82164083 CAGGCATGCACCACCATGTCTGG + Intronic
1071268298 10:83983820-83983842 CAGGCAGGTCCAGGCCTGTCAGG + Intergenic
1072427180 10:95339359-95339381 CAGGCATGCAGAGGCATGCTAGG - Intronic
1072758833 10:98039205-98039227 CAGGCATGCACCGCCGTGCCCGG - Intergenic
1072995168 10:100237099-100237121 CAGGCTGACACAGGCTTGTCTGG - Intronic
1073023011 10:100462631-100462653 CAGGAAAGCACAGTCCTTTCTGG + Intergenic
1073058939 10:100721635-100721657 CATGCATGCAGACGCCTGTAGGG - Intergenic
1073437341 10:103527435-103527457 CAGGCATGCACAACCATGCCAGG + Intronic
1073802157 10:107053854-107053876 CTGAAATGCACATGCCTGTCTGG + Intronic
1074411047 10:113228958-113228980 CAGGCATGCACCATCATGTCCGG + Intergenic
1074498663 10:114002498-114002520 GAGGGATGCACAGCCCTGTGGGG - Intergenic
1074976121 10:118583118-118583140 CAGGCATGCACCATCATGTCGGG + Intergenic
1075324761 10:121522413-121522435 CAGGCATGCACCACCATGTCTGG - Intronic
1075373239 10:121955585-121955607 CAGGCATGCACCAGCATGCCCGG + Intergenic
1075872142 10:125778650-125778672 CAGGTGTGCACAGGCCTGTGTGG + Intergenic
1076287278 10:129312513-129312535 CACACATGCCCAGGCCTCTCTGG - Intergenic
1076439825 10:130473549-130473571 CTGGCATTCCCTGGCCTGTCTGG - Intergenic
1076662148 10:132062850-132062872 CTGGAAGGCGCAGGCCTGTCTGG + Intergenic
1076715570 10:132362236-132362258 CAGGCAGCCACAGGCCCATCAGG + Intronic
1077329942 11:1979775-1979797 CACCCGTGCACAGGCCTGTGGGG + Intronic
1077433828 11:2528777-2528799 CCGGCATGCACAGGCAGATCTGG + Intronic
1077453874 11:2666341-2666363 CAGGCAAGCACATGCTTGCCAGG - Intronic
1077583989 11:3436513-3436535 CAGGCATGCATTGACATGTCTGG + Intergenic
1078905830 11:15686960-15686982 CAGGCATGCACACCCATGCCTGG + Intergenic
1079138390 11:17789840-17789862 CAGGCATGCACCACCATGTCTGG - Intronic
1080190733 11:29545195-29545217 CAGGCATGCACCACCATGTCTGG - Intergenic
1080463944 11:32479752-32479774 AAGGAATGCACAGGCCTCTTTGG + Intergenic
1080464573 11:32484844-32484866 AAGGAATGCACAGGCCTCTTTGG - Intergenic
1081279176 11:41187294-41187316 CAGGCATGCACACAAGTGTCTGG + Intronic
1081503616 11:43691793-43691815 CAGGAAAGCACAGGCATGTCTGG - Intronic
1081646759 11:44795583-44795605 CAGGCATGCACTGGACTTCCAGG + Intronic
1081800792 11:45857908-45857930 TAGCCATGCACAGGCTGGTCTGG - Intronic
1082041024 11:47685065-47685087 CAGGCATGCACAACCATGCCTGG - Intronic
1082059901 11:47851005-47851027 CAGGCATGCGCTGCCCTGCCTGG + Intergenic
1082063286 11:47878688-47878710 TAGGCATGCACAATCATGTCTGG + Intergenic
1082293613 11:50412205-50412227 CAGGCTTGTCCAGTCCTGTCTGG + Intergenic
1082800594 11:57411520-57411542 CAGGCATGCACTACCATGTCTGG - Intronic
1084079093 11:66807426-66807448 CAGGCATGCACAACCATGCCTGG - Intronic
1084240896 11:67819182-67819204 CAGGCATGCATTGCCATGTCTGG + Intergenic
1084632609 11:70364000-70364022 CAGGCATGCACAGCCATGCTTGG + Intronic
1084751474 11:71206941-71206963 CAGGCATGCACAACCATGCCTGG - Intronic
1084831544 11:71773524-71773546 CAGGCATGCATAGCCATGTCTGG - Intergenic
1084854418 11:71973041-71973063 CAGGCATGCACCACCATGTCCGG - Intronic
1085609776 11:77936523-77936545 AAGGCATGCACAACCATGTCTGG + Intronic
1085790485 11:79493486-79493508 CAGGCATGGACAAGCTTGGCGGG + Intergenic
1086367428 11:86121919-86121941 CAGGCATGCACCGCCATGCCCGG + Intergenic
1087079419 11:94155369-94155391 CAGGCATGCACCAGCATGCCTGG - Intronic
1087841046 11:102921406-102921428 CAGGCATGCACCGCCATGCCCGG - Intergenic
1088239859 11:107762160-107762182 CAGGCATGCACCATCATGTCCGG - Intergenic
1089484272 11:118832678-118832700 CAGGCATGCACAACCATGCCAGG - Intergenic
1089576146 11:119445586-119445608 CAGTCATGCACAGGACTGGTCGG - Intergenic
1089666688 11:120025119-120025141 CAGGCATGCACAGACATGTCTGG - Intergenic
1090041085 11:123292112-123292134 CAGGCATGCACCACCCTGCCTGG - Intergenic
1090185084 11:124733137-124733159 CAGGCATGCACCACCATGTCTGG + Intergenic
1090414322 11:126530225-126530247 CAGGTATGCACCAGCATGTCCGG + Intronic
1090596023 11:128322190-128322212 CAGGCGTGCACTGTCTTGTCCGG + Intergenic
1090784959 11:130040775-130040797 CAGGCACCTGCAGGCCTGTCTGG - Intergenic
1090997959 11:131884264-131884286 CAGGCATGCACCACCATGTCCGG - Intronic
1202812920 11_KI270721v1_random:34954-34976 CACCCGTGCACAGGCCTGTGGGG + Intergenic
1092411128 12:8253759-8253781 CAGGCATGCATCGCCATGTCTGG + Intergenic
1093292472 12:17344806-17344828 CAGGGATGAACAGGCTTCTCAGG - Intergenic
1093559849 12:20524987-20525009 CAGGCATGCACCACCATGTCTGG - Intronic
1093983659 12:25502871-25502893 CATGTATGCACAAGCCTATCAGG - Intronic
1094327392 12:29255765-29255787 CAGGCATGCACCACCATGTCTGG + Intronic
1095635012 12:44422732-44422754 AAGGTATGCACAAGCCTGTGAGG - Intergenic
1095770162 12:45945677-45945699 CAGGCATGCACCACCTTGTCAGG + Intronic
1095901972 12:47337262-47337284 CAGGCATGCACCAGCATGCCTGG + Intergenic
1095923537 12:47555755-47555777 CAGGCATGCACAACCATGCCCGG - Intergenic
1095977380 12:47949060-47949082 CAGCCAAGTACAGGCCTGACAGG - Intergenic
1095997311 12:48099182-48099204 CAGGCATGCACCACCATGTCTGG - Intronic
1096249732 12:50022437-50022459 CAGGCATGCACCGTCATGCCTGG - Intronic
1096898319 12:54847470-54847492 CAGGCATGCACCGCCATGACAGG - Intronic
1097206885 12:57330107-57330129 CAGGCATGCACTGACATGCCTGG + Intronic
1097208442 12:57344975-57344997 CAGGCATGCACCACCATGTCCGG + Intronic
1097232045 12:57518799-57518821 CAGGCATGCACTGCCATGCCCGG + Intronic
1097794581 12:63847601-63847623 CAGGCATGCACCACCATGTCCGG - Intronic
1098231396 12:68375149-68375171 TAGCCATGCCCAGGCCTGTCTGG - Intergenic
1098432975 12:70440619-70440641 CAGGCATGCACCACCATGTCCGG - Intergenic
1098439884 12:70506118-70506140 CAGGCATGCACTGCCATGCCAGG - Intergenic
1098697777 12:73581242-73581264 CAGGTATGCACAGAAGTGTCTGG + Intergenic
1098791350 12:74828126-74828148 CAGGCATGCACAACCATGCCTGG - Intergenic
1098874634 12:75854173-75854195 CAGGCATGCACCACCATGTCGGG - Intergenic
1100024816 12:90114962-90114984 CAGGCATGCACCACCATGTCTGG - Intergenic
1100308462 12:93372648-93372670 CAGGCATGCACCAGCATGCCTGG - Intergenic
1100588222 12:95999228-95999250 CAGGCATGCACCACCATGTCTGG - Intergenic
1100827087 12:98484557-98484579 CAGGCATGCACCGTCATGCCCGG - Intergenic
1100997836 12:100321905-100321927 CAGGCATGCACTGCCATGCCTGG - Intronic
1101307467 12:103543468-103543490 CAGGCATGCACTACCATGTCTGG - Intergenic
1101774347 12:107779988-107780010 CAGGCATGCACCACCCTGCCTGG - Intergenic
1102061378 12:109934521-109934543 CAGGCATGCACCGCCATGCCTGG + Intronic
1102428359 12:112862260-112862282 CAGGCATGCACAACCATGCCCGG - Intronic
1102597035 12:114000846-114000868 CAGGCATGCACCACCATGTCCGG + Intergenic
1103216711 12:119207363-119207385 CAGGCCTGTACAGGGCTCTCTGG - Intronic
1103474242 12:121206903-121206925 CAGGCATGCACCAGCATGGCTGG + Intergenic
1104185535 12:126426822-126426844 CAGGCATGCACCACCCTGCCAGG - Intergenic
1104372062 12:128232220-128232242 AAATCATGCACAGGCCTGACTGG + Intergenic
1104427376 12:128688934-128688956 CAGGCATGCACCACCATGTCTGG + Intronic
1104491228 12:129195244-129195266 CAGGCAGGCACAGGCCTGGGAGG + Intronic
1104933912 12:132354532-132354554 CAGGGACGCCCACGCCTGTCAGG - Intergenic
1106405415 13:29469116-29469138 CAGCAAGGCACAGGCCTCTCAGG - Intronic
1106524247 13:30526197-30526219 CAGGCATGCACCACCATGTCTGG + Intronic
1106530494 13:30586195-30586217 CAGGCATGCACAGCTATGCCTGG + Intronic
1106595619 13:31133109-31133131 CAGGCATGCACCAGCACGTCTGG - Intergenic
1106978783 13:35252995-35253017 CAGGCATGTTCAGCCCTGTCAGG - Intronic
1108011628 13:46019724-46019746 CAGGCATGCACCACCATGTCAGG + Intronic
1108139085 13:47399354-47399376 CAGGCATGCACGGCCATGTCTGG - Intergenic
1108642178 13:52393513-52393535 CAGGCATGCACTGCCATGCCCGG - Intronic
1109190120 13:59313654-59313676 CAGGCATGCACCACCATGTCTGG - Intergenic
1113109975 13:106812676-106812698 CAGGCATGCACAACCATGCCTGG + Intergenic
1113157135 13:107336208-107336230 CAGGCATGCACCACCATGTCAGG - Intronic
1113700254 13:112380260-112380282 CAGGCATGCACCACCATGTCTGG - Intronic
1113948091 13:114056121-114056143 CAGGCAGGCACAGGCCCATGTGG - Intronic
1114340341 14:21736491-21736513 CAGGCATACACAGAAGTGTCAGG - Intergenic
1114491245 14:23103409-23103431 CAGGCATGCACCACCATGTCCGG - Intergenic
1115253392 14:31373062-31373084 CAGGCATGCACCACCATGTCTGG + Intronic
1116019232 14:39441204-39441226 CAGGCATGCACACACCTGGCTGG - Intergenic
1116469996 14:45275711-45275733 CAGGCATGCACCAGCGTGCCTGG + Intergenic
1117250590 14:53933561-53933583 CAGGCATGCACCACCATGTCTGG - Intergenic
1117390733 14:55259994-55260016 CAGGCATGCACAACCATGCCTGG - Intergenic
1117455721 14:55894959-55894981 CAGGCATGCACAACCATGCCTGG + Intergenic
1117553423 14:56859185-56859207 CAGGCATGCACCACCATGTCTGG + Intergenic
1117676975 14:58165355-58165377 CAGGCATGCACCACCATGTCTGG - Intronic
1117739739 14:58804616-58804638 CAGGCATGCACAAGCATGCCTGG - Intergenic
1117800024 14:59433819-59433841 CAGGCATGCACCACCATGTCCGG + Intronic
1117830992 14:59750854-59750876 CAGGCATGCACCAGCATGACTGG + Intronic
1118195019 14:63617219-63617241 CAGGCATGCACCACCATGTCTGG + Intronic
1118252767 14:64178599-64178621 CAGGCATGCACCGCCATGCCCGG + Intronic
1118363037 14:65071834-65071856 AACCCATGCACAGGCCTGCCTGG + Intronic
1118755183 14:68837886-68837908 CAGGCATGCACTGCCATGTCTGG - Intergenic
1119371784 14:74152118-74152140 CAGGCATGCACCATCATGTCAGG - Intronic
1119566125 14:75630819-75630841 CAGGAATGACCAGGCCTTTCAGG + Intronic
1119613531 14:76083352-76083374 CAGGGAGGCACAGGCCAGCCCGG - Intronic
1119666332 14:76487744-76487766 CAGGCATGCACCACCATGTCCGG + Intronic
1120398828 14:84002542-84002564 CAGGCATGCACCGCCATGCCTGG - Intergenic
1121311195 14:92936064-92936086 CAGCCATGCTCAGGCCTACCAGG - Intergenic
1121356275 14:93217949-93217971 CAGGCATGCACCAGCATGCCTGG - Intronic
1121380635 14:93462979-93463001 CATCCATCCACAGGACTGTCAGG - Intronic
1121606253 14:95242399-95242421 CAGGCATGCACCGCCATGCCTGG + Intronic
1121646508 14:95521178-95521200 CAGGCATGCACCACCCTGCCTGG - Intergenic
1122127710 14:99588061-99588083 CAGGCCTGCACAGGCCTCCTGGG + Intronic
1122264397 14:100539915-100539937 AAGGAACGCACAGGCCTGGCTGG + Intronic
1122535218 14:102457225-102457247 CAGGCATCCACAGCCATGCCCGG + Intronic
1122536596 14:102468328-102468350 CAGGCATGCACCGCCATGCCTGG + Intronic
1122847942 14:104510931-104510953 CAGGCGAGCAGAGGCCCGTCTGG + Intronic
1122865437 14:104601893-104601915 CTGGTATGCTCAGGCCTGTGGGG - Intronic
1122924454 14:104893199-104893221 GAGGCATGCAAAGGGCTGTGGGG - Intronic
1122969294 14:105145979-105146001 CAGGCACGCACAGGAGGGTCAGG + Intronic
1124224937 15:27885425-27885447 CAGGCATGAACAGGCCTGCATGG + Intronic
1124261751 15:28199002-28199024 CAGGCATGCACCGCCACGTCTGG - Intronic
1125619501 15:41047108-41047130 CAGGCATGCACCACCATGTCCGG + Intronic
1125741036 15:41964912-41964934 CAGGCATGCACCACCATGTCCGG + Intronic
1125796781 15:42409244-42409266 CAGAGGTGCACAGGCCTGTGAGG - Intronic
1126125355 15:45290625-45290647 CAGGCATGCACCACCCTGCCTGG + Intergenic
1126591168 15:50341387-50341409 CAGGCATGCACCGCCATGCCTGG - Intronic
1126755375 15:51920478-51920500 CAGGCATGCACCGCCATGCCCGG - Intronic
1127089167 15:55449519-55449541 CAGGCATGCGCCAGCATGTCTGG - Intronic
1127294381 15:57596887-57596909 GTGGCATGCACAGGCCTCTAGGG - Intronic
1127516435 15:59697897-59697919 CAGGCATGCACCAGCATGCCCGG - Intergenic
1128133575 15:65246523-65246545 CAGGCAGGCACAGACATGTCAGG + Intronic
1128476692 15:68003470-68003492 CAGGCATGCACCAGCATGCCCGG + Intergenic
1129365789 15:75053397-75053419 CAGGCATGCACCACCATGTCTGG - Intronic
1129387648 15:75204648-75204670 CAGGCATGCACAACCATGCCTGG + Intronic
1129563037 15:76591915-76591937 CAGGCATGCGCCACCCTGTCTGG - Intronic
1129608942 15:77038141-77038163 CAGGCAGGCCCAGGACTGTAAGG + Intergenic
1129770165 15:78198177-78198199 CAGGCATGCACCACCATGTCTGG + Intronic
1129934119 15:79435131-79435153 CAGGCATGCACCGCCATGCCTGG - Intronic
1130171595 15:81520394-81520416 CAGGCATGCACTGCCATGCCAGG - Intergenic
1130381919 15:83378999-83379021 CAGACCGGCCCAGGCCTGTCAGG - Intergenic
1130536935 15:84792591-84792613 CAGGCATGCACTGCCATGCCTGG + Intronic
1130538257 15:84802336-84802358 CAGTCAACCACAGGCCTCTCAGG + Exonic
1130625330 15:85508283-85508305 CAGGCATGCACTACCGTGTCTGG + Intronic
1130788770 15:87129329-87129351 CAGGCATGCACAACCATGCCTGG - Intergenic
1130961369 15:88660631-88660653 CAGGCATGCACCACCATGTCTGG - Intergenic
1131515606 15:93074298-93074320 CAGCCTTGCACAAGCCTGTGTGG - Intronic
1132048734 15:98589126-98589148 CAGGCATGCACTGTCATGCCTGG - Intergenic
1132086115 15:98909625-98909647 AAGGGAAGCACAGGCCTGTGGGG + Intronic
1132837395 16:1960972-1960994 TAGGCCTTCACAGGCCTGCCTGG + Intronic
1132860943 16:2071502-2071524 CAGGAAGTCAAAGGCCTGTCAGG - Exonic
1132932275 16:2464742-2464764 CAGGGAAGCACAGGCATCTCTGG - Exonic
1133065104 16:3200462-3200484 CAGGCATGCACTGCCATGTCCGG - Intergenic
1133116805 16:3582231-3582253 CAGGCCTCCACAGGCATTTCTGG - Exonic
1133352368 16:5110079-5110101 CAGGCATGCATCGCCATGTCTGG + Intergenic
1133476235 16:6124643-6124665 CAGGCATGCACCAGCATGCCCGG + Intronic
1133612781 16:7449070-7449092 CAGGCATGCACCAGCATGCCCGG + Intronic
1133668586 16:7995289-7995311 CAGGCATGCACCACCATGTCTGG + Intergenic
1134069349 16:11251014-11251036 CAGGCATGCACCACCATGTCTGG - Intronic
1134808020 16:17142164-17142186 CAGGCATGCACCGCCATGTCTGG + Intronic
1134904021 16:17963914-17963936 CAGGCATGCACAACCATGCCCGG + Intergenic
1135069751 16:19341477-19341499 CAGGCATGCACCACCATGTCTGG - Intergenic
1135580950 16:23625836-23625858 CAGGCATGCACCACCATGTCTGG - Intronic
1135624947 16:23986393-23986415 CAGGCATGCACCACCATGTCTGG + Intronic
1135768622 16:25199251-25199273 CAGGCATGCACCACCATGTCTGG - Intergenic
1135846199 16:25920742-25920764 CAGGCATGCACCAGCATGCCTGG + Intronic
1136070262 16:27783162-27783184 CAGGCATGCGCAGTGCTCTCTGG + Intergenic
1136315349 16:29451706-29451728 CTGGCAGGAACAGGTCTGTCAGG + Intronic
1136429926 16:30191048-30191070 CTGGCAGGAACAGGTCTGTCAGG + Intergenic
1136610763 16:31363586-31363608 CAGGCATGCACCACCATGTCCGG + Intronic
1136621176 16:31429367-31429389 CAGGCAGCCACAAGCCTGACAGG + Intergenic
1137263303 16:46848335-46848357 CAGGCATGCACCAGCATGCCTGG - Intergenic
1137386378 16:48046645-48046667 CAGGCATGCACCACCCTGTCTGG - Intergenic
1137423539 16:48356880-48356902 CAGGCTTGCACTGTCATGTCAGG - Exonic
1137575893 16:49600167-49600189 CAGGCATGCACCACCATGTCTGG - Intronic
1137646880 16:50082931-50082953 CAGGCATGCACCGCCATGCCTGG + Intronic
1138172283 16:54863951-54863973 CAAACATTCATAGGCCTGTCTGG + Intergenic
1138221913 16:55259023-55259045 CTGGCATGCCAAGGCCTGGCGGG + Intergenic
1138349431 16:56338649-56338671 AAGCCATCCACAGGCCTGGCAGG - Intronic
1138410257 16:56833744-56833766 CAGGTATGCACATGCCTGGCTGG - Intronic
1138554692 16:57764622-57764644 CAGGAGGGCACAGGCCTGGCAGG + Intronic
1138743652 16:59338422-59338444 CAGGCATGCACAACCACGTCCGG - Intergenic
1139022275 16:62764290-62764312 CAGGCATGCACCGCCATGCCTGG + Intergenic
1139194693 16:64905433-64905455 CAGGCATGCACCACCATGTCTGG - Intergenic
1139385123 16:66562861-66562883 CAGGCATGCACCACCATGTCTGG + Intronic
1139495772 16:67316182-67316204 CAGGCATGCACCATCATGTCTGG + Intronic
1139811617 16:69623648-69623670 CAGGCATGCACCACCATGTCCGG + Intronic
1140461920 16:75146795-75146817 CAGGCATACACAGCCATGCCTGG - Intergenic
1140684917 16:77424323-77424345 CAGGCATGCACTGCCATGTCCGG - Intronic
1140818742 16:78644077-78644099 CAGGCATGCACCACCATGTCTGG - Intronic
1141104476 16:81222049-81222071 CAGGCATGCACAACCATGCCTGG - Intergenic
1141406098 16:83794408-83794430 CAGGCATGCACCGCCATGCCTGG - Intronic
1141453604 16:84122498-84122520 CAGGCATGCACCACCCTGCCTGG + Exonic
1141468286 16:84221517-84221539 CAGGCATCCCCAGGCATGCCTGG - Exonic
1141606438 16:85156552-85156574 GAGGCAGCCACAGGGCTGTCAGG + Intergenic
1141741140 16:85893934-85893956 AAGGAATGGACAAGCCTGTCAGG + Intergenic
1141799015 16:86294777-86294799 CGGGCAGGCACACGCCTGTGTGG - Intergenic
1142512588 17:406423-406445 CAGGCATGCACAAACATGCCAGG - Intergenic
1142616404 17:1138618-1138640 CAGGCATGCACAACCATGCCTGG + Intronic
1143095342 17:4475882-4475904 CCAGCATGCACTGGCCTGTGAGG + Intronic
1143229355 17:5339012-5339034 CAGGCATGCACCACCGTGTCTGG - Intronic
1143726098 17:8847658-8847680 CAGGCATGCACCACCATGTCCGG - Intronic
1143802059 17:9391307-9391329 CAGGCATGCACCACCATGTCTGG - Intronic
1143803177 17:9402260-9402282 CAGGCATGCACCACCATGTCTGG + Intronic
1143816982 17:9524948-9524970 CAGGCATGCACCACCATGTCTGG + Intronic
1144361385 17:14497787-14497809 CAGGCATCCACAATCATGTCCGG - Intergenic
1144573211 17:16413568-16413590 CAGGCATGCACCACCATGTCTGG - Intergenic
1144712296 17:17409731-17409753 CAGGCATGACCAGGGCTGGCGGG - Intergenic
1144825814 17:18105158-18105180 CAGGCATGCACAGGCCCCAGGGG + Intronic
1144878449 17:18416712-18416734 CAGGCATGCACCGCCATGCCTGG - Intergenic
1145008868 17:19355384-19355406 CAGGCATGCACCACCATGTCCGG - Intronic
1145153784 17:20527681-20527703 CAGGCATGCACCGCCATGCCTGG + Intergenic
1145201592 17:20950234-20950256 CAGGCATGCACAATCATGTCTGG + Intergenic
1146117983 17:30159799-30159821 CAGGCATGCACCACCATGTCTGG + Intronic
1146357542 17:32146863-32146885 CAGGCATGCACCACCATGTCTGG + Intronic
1146791598 17:35753683-35753705 CAGGCAGGCACAGGTCTGAGTGG + Intronic
1146839288 17:36138675-36138697 CAGGCATGCACAATCATGCCCGG - Intergenic
1147337210 17:39734389-39734411 CAGGCATGCACCACCATGTCTGG + Intergenic
1147413078 17:40268003-40268025 CAGGCATGCACCGCCATGCCAGG - Intronic
1147642675 17:42013934-42013956 CAGGCATGCACCGCCATGCCTGG + Intronic
1147942076 17:44056128-44056150 CAGGCATGCACCAGCATGCCCGG - Intronic
1148078125 17:44951362-44951384 CAGGCATGCACCATCCTGCCCGG + Intergenic
1148095463 17:45050181-45050203 CAGGCATGCACCACCATGTCCGG + Intronic
1148408756 17:47445912-47445934 CAGGCATGCACCATCATGTCTGG - Intergenic
1148583016 17:48756603-48756625 CAGGCATGCACCACCATGTCTGG - Intergenic
1148612673 17:48974812-48974834 CAGGCATGCACAACCATGCCTGG + Intergenic
1148800033 17:50219040-50219062 CAGGCATGCACCACCATGTCTGG - Intergenic
1148886101 17:50774116-50774138 CAGGCATGCACCAGCATGCCTGG + Intergenic
1149879385 17:60273113-60273135 CAGGCATGCACCAGCATGCCTGG + Intronic
1149903744 17:60506131-60506153 CAGGCATGCACAACCATGCCTGG + Intronic
1150032441 17:61753742-61753764 CAGGTATGCACTGCCATGTCTGG + Intronic
1150203989 17:63386993-63387015 CAGGCATGCACCAGCATGCCTGG + Intronic
1150312913 17:64144065-64144087 CAGGCATGCACAACCATGCCTGG - Intergenic
1150438180 17:65170195-65170217 CAGGCATGCACCACCATGTCCGG + Intronic
1150558487 17:66275022-66275044 CAGGCATGCACCACCATGTCAGG - Intergenic
1150700227 17:67440673-67440695 CAGGCATGCACCGTCATGCCTGG + Intronic
1150749161 17:67844224-67844246 CAGGCATGCACCACCATGTCTGG + Intronic
1150757271 17:67926148-67926170 CAGGCATGCACCACCGTGTCTGG + Intronic
1151109073 17:71653953-71653975 CAGGCATGCACCACCATGTCTGG - Intergenic
1151788610 17:76289327-76289349 CAGGCATGCACCACCATGTCTGG + Intronic
1151806581 17:76409536-76409558 CAGGCATGCACAACCATGCCCGG + Intronic
1151990003 17:77568416-77568438 CAGGCATGCACCACCATGTCTGG + Intergenic
1152408301 17:80109785-80109807 CATGCCTGCACACGCCTGCCTGG - Intergenic
1152409733 17:80117378-80117400 CTGGCATACCCAGGCCTCTCAGG + Intergenic
1152435951 17:80276241-80276263 CAGGCATGCACCACCATGTCTGG + Intronic
1152483936 17:80577172-80577194 CAGGCATGCACCACCATGTCTGG + Intronic
1152801352 17:82332343-82332365 CAGGCATGCGCAGGCGTGCTGGG - Intronic
1152820649 17:82436064-82436086 CAGGAGAGCACAGGCCTGCCTGG + Intronic
1153241229 18:3033169-3033191 CAGGCATGCACAACCACGTCTGG - Intergenic
1153299488 18:3580702-3580724 CAGTCAACCACAGGCCTCTCAGG + Intronic
1153896475 18:9566506-9566528 CAGGCATGCACCGCCATGCCTGG - Intronic
1154166684 18:12020334-12020356 CAGGCATGCACCACCATGTCTGG + Intronic
1154168152 18:12031309-12031331 CAGGCATGCACTAGCATGCCAGG + Intergenic
1154411609 18:14144969-14144991 CAGGTGTGGGCAGGCCTGTCTGG + Intergenic
1155119256 18:22801794-22801816 CAGGCATGCACCAGCATGCCAGG - Intronic
1155462086 18:26093922-26093944 CAGGCATGCACCGCCATGCCTGG + Intergenic
1155619684 18:27763911-27763933 CAGGCATGTACATGCATGTGTGG + Intergenic
1156225367 18:35100894-35100916 CAGGCATGCACCACCATGTCTGG - Intronic
1156306378 18:35881433-35881455 CAGGCATGGACAAGCATGCCTGG + Intergenic
1157659541 18:49427946-49427968 CAGGCATGCACCGCCATGCCTGG - Intronic
1157668294 18:49506457-49506479 CAGGCATGCACAACCATGCCCGG - Intergenic
1158283062 18:55849000-55849022 CAGGCATGCACCGCCATGCCTGG - Intergenic
1158829437 18:61261615-61261637 CAGGCATGCACTGCCATGCCTGG + Intergenic
1159074880 18:63668880-63668902 CAGGCATGCACCGCCATGCCTGG - Intronic
1159091627 18:63855661-63855683 CAGGCATGCACCAACATGTCTGG + Intergenic
1159954559 18:74510173-74510195 CATCCATGAACAGGGCTGTCTGG + Intronic
1160136592 18:76276798-76276820 CAGGAATGCAGTGGCCTGTGGGG + Intergenic
1160203877 18:76817256-76817278 CAGGCATGCACCACCATGTCTGG + Intronic
1160275251 18:77426636-77426658 CAGGCATGCACAACCATGCCCGG - Intergenic
1160404340 18:78634860-78634882 GAGGCCTGCACAGCCCTGACGGG - Intergenic
1161074765 19:2280203-2280225 CAGGCATGCACCACCATGTCTGG + Intronic
1161181441 19:2885697-2885719 CAGGCATGCACGACCCTGCCCGG + Intergenic
1161240916 19:3223385-3223407 CAGGCATGCACAACCATGCCTGG + Intergenic
1161486901 19:4541050-4541072 CAGGCATGCACCAGCGTGCCTGG + Intergenic
1161487873 19:4545478-4545500 CAGGCATGCACTGCCACGTCTGG + Intronic
1161701395 19:5797887-5797909 CAGGCATCCCCAGTCCTGCCGGG - Intergenic
1161868427 19:6852154-6852176 CAGGCATGCACTGTCATGCCTGG + Intronic
1162042066 19:7976963-7976985 CAGGCATGCACCACCCTGCCTGG + Intronic
1162303233 19:9856239-9856261 CAGGCATGCACCACCATGTCCGG + Intronic
1162350653 19:10147117-10147139 CAGGCATGCACCACCCTGCCTGG - Intronic
1162374892 19:10299016-10299038 CAGGCATGCACCACCATGTCTGG - Intergenic
1162780125 19:13002468-13002490 CAGGGGGGCACAGGCCTGGCGGG + Intronic
1162817224 19:13203362-13203384 CAGGCATGCACCGCCATGCCGGG + Intergenic
1162861784 19:13511202-13511224 CAGGCATGCACCAGCATGCCCGG - Intronic
1163081190 19:14943461-14943483 CAGGCATGCACCACCATGTCTGG + Intergenic
1163403219 19:17107091-17107113 CAGGCATGCACTGCCATGCCTGG - Intronic
1163418125 19:17199058-17199080 CAGGCATGCACCGCCCTGCCTGG - Intronic
1163556258 19:17994684-17994706 CAGGCATGCACCAGCATGCCCGG + Intronic
1163569736 19:18073965-18073987 CAGGCATGCACCACCATGTCCGG + Intronic
1163616905 19:18334694-18334716 CAGGCATGCACCACCATGTCTGG + Intergenic
1163728317 19:18934982-18935004 CAGGCATGCACCAGCATGCCTGG + Intronic
1163842834 19:19621784-19621806 CAGGCATGCACCACCATGTCTGG - Intergenic
1163847797 19:19647081-19647103 CAGGGATGCATGGGCCTGCCAGG - Intronic
1163876127 19:19869810-19869832 CAGGCATGCACCACCATGTCCGG + Intronic
1163935437 19:20438436-20438458 CAGGCATGCACAAGGATGCCTGG + Intergenic
1164039906 19:21485047-21485069 CAGGCATGCACCATCCTGCCTGG + Intronic
1164045809 19:21539562-21539584 CAGGCATACACCAGCATGTCTGG + Intronic
1164122693 19:22282606-22282628 CAGGCATGCACCACCATGTCTGG + Intergenic
1164245370 19:23423534-23423556 CCGGCATGCACCAGCCTGCCTGG + Intergenic
1164588594 19:29493926-29493948 CAGGCATGCACCTCCATGTCTGG - Intergenic
1164897888 19:31893031-31893053 CAGGCATGCACAACCATGCCTGG - Intergenic
1165082849 19:33319850-33319872 CAGGCATGCACCACCATGTCTGG + Intergenic
1165082980 19:33321035-33321057 CAGGCATGCACCACCATGTCTGG - Intergenic
1165260027 19:34605728-34605750 CAGGCATGCACCACCATGTCTGG + Intronic
1165336887 19:35176926-35176948 CAGGCATGCACCGCCATGCCTGG - Intergenic
1165441983 19:35833837-35833859 CAGGCATGCACTGCCATGCCTGG + Intronic
1165647804 19:37458011-37458033 CAGGCATGCACAACCATGCCTGG + Intronic
1165936915 19:39394994-39395016 CAGGCATGCACTGCCATGCCTGG + Intronic
1165950760 19:39472934-39472956 CAGGCCTCCACAGGCCTCGCAGG - Intronic
1166364494 19:42271799-42271821 AAGGCATGCACTGGCCTTTCAGG + Intronic
1166729054 19:45047940-45047962 CAGGCATGCACCAACCTGCCTGG - Intronic
1167097338 19:47381322-47381344 CAGGTAAGCACAGGACTGTGGGG + Exonic
1167211183 19:48135079-48135101 TCTGCATGCACAGCCCTGTCTGG + Intronic
1167330162 19:48850672-48850694 CAGGCATGCACCACCATGTCTGG - Intronic
1167940813 19:52944407-52944429 CAGGCATGCACCAGCATGCCCGG - Intronic
1168054846 19:53857335-53857357 CAGGCATGAGCTGCCCTGTCCGG + Intergenic
1168060420 19:53889093-53889115 CAGGCATGCACCACCATGTCCGG + Intronic
1168082150 19:54018015-54018037 CAGGCATGCACCGCCATGCCTGG - Intergenic
1168486861 19:56770452-56770474 CAGGCATGCACCACCCTGCCCGG - Intergenic
1168614299 19:57825429-57825451 CAGGCATGCACAATCATGCCCGG + Intronic
924974671 2:161624-161646 TAGGGATGCACAGCCCTGTGTGG + Intergenic
925542175 2:4977944-4977966 CAGGCATGCACCACCATGTCCGG - Intergenic
926136645 2:10341316-10341338 CAGGCATGCACCACCGTGTCTGG - Intronic
926184001 2:10674073-10674095 CAGGCATGCACCACCATGTCTGG - Intronic
926668370 2:15550019-15550041 CAGGCATGCACCAGCATGCCTGG - Intronic
927013053 2:18926613-18926635 CAGGCATGCACAACCATGCCTGG - Intergenic
927312784 2:21649346-21649368 GAGGCATGCAGAGGCCTCTTTGG + Intergenic
927421494 2:22937143-22937165 CAGGCATGCACAGCCATGCCCGG + Intergenic
927694779 2:25232297-25232319 CAGGCAAGCACCTGCCCGTCGGG + Exonic
927702896 2:25279152-25279174 AAGACAAGCACAGGCCTGTCGGG + Intronic
927807800 2:26163234-26163256 CAGGCATGCACCACCATGTCTGG - Intergenic
928398911 2:30964204-30964226 CAGGCATGCCCAGTCATGACCGG + Intronic
928606806 2:32950580-32950602 CAGGCATGCACCACCATGTCTGG - Intronic
929574004 2:43041002-43041024 CAGGCATGCACTGCCATGCCTGG + Intergenic
929758305 2:44786054-44786076 CAGGCATGCACCGCCATGCCCGG - Intergenic
930044157 2:47154586-47154608 CAGGCATGCACCGCCATGGCTGG - Intronic
930186540 2:48417605-48417627 CAGGCATGCACCACCATGTCTGG - Intergenic
930589648 2:53312127-53312149 CAGGCATGCACCACCATGTCTGG - Intergenic
930622432 2:53658332-53658354 CAGGCATGCACCAGCATGCCTGG - Intronic
931764439 2:65442365-65442387 CAGGCATGCACCAGCATGGCCGG - Intergenic
932130372 2:69181973-69181995 CAGGCATGCCCAGGGCAGTATGG + Intronic
932475116 2:72000618-72000640 CAGGCATGGACAGGCCAGCCAGG - Intergenic
933968092 2:87446895-87446917 CAGGCATGCACCACCATGTCTGG + Intergenic
933972245 2:87479600-87479622 CAGGCATGCACCGTCATGCCTGG + Intergenic
934295757 2:91741807-91741829 AAGGCATGCAAGGGCCTGTGTGG + Intergenic
934499260 2:94841750-94841772 CAGGCATGCACAATCATGCCTGG - Intergenic
934539724 2:95163796-95163818 CAGGCATGCACCACCATGTCTGG - Intronic
935168957 2:100595221-100595243 CAGGCATGCACTGCCATGCCTGG + Intergenic
935886451 2:107624728-107624750 CAGGCATGCACTGCCATGCCTGG + Intergenic
936102871 2:109598698-109598720 CAGGCATGCACTGCCATGCCTGG - Intronic
936107793 2:109640307-109640329 CAGGCATGCACCAGCATGCCTGG - Intergenic
936321484 2:111470588-111470610 CAGGCATGCACCGTCATGCCTGG - Intergenic
936325704 2:111503609-111503631 CAGGCATGCACCACCATGTCTGG - Intergenic
937078914 2:119126553-119126575 CAGGCCTGCAGAGCCCTGTGGGG - Intergenic
937177625 2:119956354-119956376 CAGGCATGCACAGCCATGCTAGG + Intronic
937182248 2:120007273-120007295 CAGGCATGCACCAGCATGCCTGG + Intergenic
937291406 2:120784405-120784427 CATGAATGCAAAGGCCTGACAGG + Intronic
937477177 2:122226095-122226117 CAGGCATGCACACGCACCTCTGG - Intergenic
937583039 2:123512448-123512470 CAGGCATGCACAACCATGCCTGG - Intergenic
937756034 2:125540009-125540031 CAGGCATGCACCAGCATGCCTGG - Intergenic
938115558 2:128601066-128601088 CACACATGCACATGCCTGTGAGG + Intergenic
938292206 2:130156261-130156283 GAGACATGCACAGCCCTGTGAGG + Intronic
938464341 2:131516708-131516730 GAGACATGCACAGCCCTGTGAGG - Intergenic
938826730 2:135013175-135013197 CAGGCATGCACCACCATGTCTGG - Intronic
938943134 2:136186870-136186892 CAGGCATGCACAACCATGCCTGG + Intergenic
939613687 2:144338555-144338577 AAGGCATGCACATGCATGTGTGG - Intergenic
940163221 2:150737471-150737493 CAGGCATGCACCAGCATGCCTGG - Intergenic
940229879 2:151439519-151439541 CAGGCATGCACCACCATGTCTGG - Intronic
940239869 2:151551108-151551130 CAGGCATGCACTGCCATATCTGG + Intronic
940932537 2:159450880-159450902 CAGGCATGCACAACCATGCCTGG + Intronic
941036142 2:160571002-160571024 CAGGCATGCACAACCATGCCCGG + Intergenic
941256795 2:163241684-163241706 CAGGCAGGCACAGGCCTCCATGG - Intergenic
941765647 2:169293530-169293552 CAGGCATGCACCACCATGTCTGG - Intronic
941818609 2:169823676-169823698 CAGGCATGCACCGTCATGCCTGG - Intronic
942215024 2:173710397-173710419 CAGGCATGCACCAGCATGCCTGG + Intergenic
942242122 2:173972304-173972326 CAGGCATGCACCCCCATGTCTGG - Intergenic
942469246 2:176242643-176242665 CAGGCATGTGCAGGACTTTCTGG - Intergenic
943007962 2:182409615-182409637 CAGGCACCCACAGGCCCATCAGG - Intronic
943364303 2:186954753-186954775 CAGGCATGCACCACCATGTCTGG - Intergenic
943442361 2:187941768-187941790 CAGGCATTTACAGACCTTTCTGG + Intergenic
943569362 2:189555024-189555046 CAGGCATGCACCACCATGTCTGG - Intergenic
943941713 2:194006742-194006764 CAGGCATGCACCGCCATGCCCGG - Intergenic
944236921 2:197449338-197449360 CAGGCATGCACAACCATGACTGG - Intergenic
944402038 2:199338772-199338794 CAGGCATGCACTGCCATGCCTGG - Intronic
944652478 2:201845004-201845026 CAGGCATGCACCAGCATGCCTGG - Intronic
944820178 2:203422153-203422175 CAGGCATGCACCACCATGTCTGG - Intronic
944841302 2:203626283-203626305 CAGGCATGCACAACCACGTCTGG - Intergenic
945088173 2:206155070-206155092 CAGGCATGCACAACCATGCCAGG + Intronic
945334654 2:208578350-208578372 CAGGCATGCACAACCATGCCTGG - Intronic
946084458 2:217156939-217156961 CAGACAGGCACAGGGCTGTGAGG + Intergenic
946756878 2:222956221-222956243 CAGGCATGCACCACCATGTCTGG + Intergenic
946980219 2:225205099-225205121 CAGGCATGCACCACCATGTCTGG + Intergenic
947216783 2:227757140-227757162 CAGGCATGCACAACCATGCCTGG - Intergenic
947491337 2:230597173-230597195 CAGGCATGCACTGCCATGCCTGG - Intergenic
947990414 2:234483360-234483382 CAGGCATGCACCACCATGTCTGG + Intergenic
948548863 2:238753987-238754009 CAGGCATGCACTTCACTGTCAGG - Intergenic
1168796888 20:616453-616475 CAGGCATGCACCAGCATGCCTGG + Intergenic
1169569638 20:6891876-6891898 CAGGCATGCACTGCCATGCCAGG - Intergenic
1170113921 20:12836611-12836633 CAGGCATGCACCGCCATGCCTGG + Intergenic
1170806518 20:19637156-19637178 CAGGCATGCACCGCCATGTCTGG - Intronic
1171067860 20:22036405-22036427 CAGGCATGCACAACCATGCCTGG + Intergenic
1172325603 20:34032103-34032125 CAGGCATGCACCGCCATGCCTGG + Intronic
1172709070 20:36906293-36906315 CAGGCATGCACCGCCATGCCCGG - Intronic
1172815340 20:37681760-37681782 AAGGCATGCACAGGCAGTTCAGG + Intergenic
1172930900 20:38585934-38585956 CAGGGATACCCAGGCCTGGCAGG + Intronic
1173376530 20:42488819-42488841 CAGGCATGCACCACCATGTCCGG - Intronic
1174195586 20:48770565-48770587 CAGGCATGCACCACCATGTCTGG - Intronic
1174460117 20:50676507-50676529 CAGGCATGCACCACCATGTCTGG - Intronic
1174566602 20:51469163-51469185 CAGGCATGCACCAGCATGCCTGG + Intronic
1174647430 20:52097923-52097945 CAGGCATGCACCACCATGTCTGG - Intronic
1175365465 20:58451848-58451870 TAGGCATGCACAAGCATGCCTGG + Intergenic
1175756483 20:61533488-61533510 CAGGCATGCCCTGCCCTCTCAGG - Intronic
1175881437 20:62261704-62261726 CAGGGATGCAGAGGCCACTCTGG - Intronic
1175887377 20:62300038-62300060 CAGGCATGCACCGCCATGGCTGG + Intergenic
1176136514 20:63524738-63524760 CAGGCATGCACCGCCACGTCTGG - Intergenic
1176170672 20:63695110-63695132 CAGACGTGCACAGACCTGACCGG + Exonic
1176203572 20:63875864-63875886 CAGGCACTCACAGGTCTGACTGG - Exonic
1176306365 21:5125461-5125483 ATGGCCTGCACAGGGCTGTCAGG + Intronic
1176334382 21:5582445-5582467 CAGGCATGAACAGCCGTGCCTGG - Intergenic
1176393375 21:6238507-6238529 CAGGCATGAACAGCCGTGCCTGG + Intergenic
1176468044 21:7077667-7077689 CAGGCATGAACAGCCGTGCCTGG - Intronic
1176491605 21:7459445-7459467 CAGGCATGAACAGCCGTGCCTGG - Intergenic
1176509037 21:7678938-7678960 CAGGCATGAACAGCCGTGCCTGG + Intergenic
1176864450 21:14037231-14037253 CAGGCATGGCCAGACCTGTAGGG + Intergenic
1176880814 21:14191099-14191121 CAGGCATGCACCACCATGTCTGG - Intronic
1177045209 21:16160505-16160527 CAGGCATGCACCACCATGTCTGG - Intergenic
1177188332 21:17821756-17821778 CAGGCATGCACCACCCTGCCTGG - Intergenic
1177515204 21:22141105-22141127 CAGGCATGCACCGCCATGCCTGG - Intergenic
1178069557 21:28948410-28948432 CAGGCATGCACCACCATGTCTGG + Intronic
1178885946 21:36484853-36484875 CAGGCATGCACCGCCATGCCTGG + Intronic
1178886012 21:36485349-36485371 CAGGCATGCACCACCATGTCTGG + Intronic
1179200613 21:39216456-39216478 CAGGGATGGTCAGGCCTGGCTGG - Intronic
1179214827 21:39358469-39358491 CAGGCATGCACAAGCATGCCTGG - Intergenic
1179226633 21:39459498-39459520 CAGGCATGCACCGCCATGCCTGG + Intronic
1179850693 21:44136569-44136591 ATGGCCTGCACAGGGCTGTCAGG - Intronic
1180008479 21:45034265-45034287 CTGGCATGCACAGCCCTGTTCGG + Intergenic
1180046331 21:45307473-45307495 CTGGGTTGCACAGGCCCGTCTGG - Intergenic
1180668225 22:17532025-17532047 CAGGCATGCACCACCATGTCTGG - Intronic
1180885569 22:19240972-19240994 CAGGCATGCACCTTCCTTTCAGG - Intronic
1180893340 22:19307929-19307951 CAGGCATGAACAACCATGTCTGG - Intergenic
1181157837 22:20935666-20935688 CAGGCATGCACCACCCTGCCCGG + Intronic
1181390273 22:22575801-22575823 CAGGCATGCACCACCATGTCCGG + Intergenic
1181508121 22:23375391-23375413 AAGGCAAGGACAGGCCTGACAGG - Intergenic
1181584111 22:23843656-23843678 CAGGCATGCACCAGCACGTCTGG - Intergenic
1182375024 22:29840350-29840372 CAGGCATGCACCAGCATGCCTGG - Intergenic
1182463373 22:30498263-30498285 CAGGCATGCACCGCCATGCCTGG + Intronic
1182505316 22:30778135-30778157 CAGGCATGCACCAGCATGCCCGG + Intronic
1182506209 22:30784913-30784935 CAGGCATGCACCACCATGTCTGG + Intronic
1182614361 22:31576780-31576802 CAGGCATGCACCACCATGTCCGG + Intronic
1183076913 22:35433075-35433097 CAGGCATGCACCACCATGTCTGG + Intergenic
1183188070 22:36303884-36303906 CAGCCAGTCACATGCCTGTCAGG - Intronic
1183314424 22:37129071-37129093 CAGCCCAGCACAGGCCTGCCTGG + Intronic
1183324361 22:37183462-37183484 CAGGCAGGCACAGCCCTGCCCGG + Intronic
1183418963 22:37698996-37699018 CAGGCATGCACCGTCATGCCTGG - Intronic
1183454410 22:37914016-37914038 CAGGCATGCACCAACATGTCCGG + Intronic
1183665028 22:39242272-39242294 CACGCATGCACACTCCTGGCCGG - Intronic
1183676691 22:39302816-39302838 CAGGCTTGGTGAGGCCTGTCTGG - Intergenic
1184644653 22:45889413-45889435 CAGGCATGGAGAGGCCAGCCAGG + Intergenic
1185094975 22:48801121-48801143 GAGGCATGCACATGCGTGTCAGG - Intronic
1185424563 22:50758864-50758886 CAGGCATGCACCACCATGTCCGG - Intergenic
949462486 3:4307904-4307926 CAGGCATGCACCACCATGTCTGG - Intronic
949994724 3:9607563-9607585 CAGGCATGCACCACCATGTCCGG + Intergenic
950110910 3:10418013-10418035 CAGGCTTACACAGGCCTTTGGGG + Intronic
950144117 3:10635692-10635714 CAGGCAGGCACAGGGCTGTATGG - Intronic
950180303 3:10907986-10908008 CAGGCATGCACCAGCATGCCAGG - Intronic
950286385 3:11748519-11748541 CAGGCATGCACCGCCATGGCTGG + Intergenic
950595822 3:13980638-13980660 CAGGCATGCACCAGCATGCCTGG + Intronic
950898278 3:16473541-16473563 CAGGCATGCACCGCCCTGCCTGG + Intronic
951482645 3:23178288-23178310 CAGGCATGCACCAGCATGCCTGG + Intergenic
952111911 3:30133962-30133984 CAGGCATGCACCACCATGTCCGG + Intergenic
952709843 3:36418902-36418924 CAGGCATGCACCACCATGTCTGG - Intronic
952805804 3:37350385-37350407 CATGCATGCACAAGCATGTTTGG - Intronic
953209147 3:40858910-40858932 CTATCATGCACAGGCTTGTCTGG + Intergenic
953552653 3:43916045-43916067 CAGGCATGCACCAGCATGCCTGG + Intergenic
953706697 3:45236618-45236640 CAGGCATGCACCACCATGTCTGG - Intergenic
954497961 3:50983073-50983095 CAAGCATGCACACACCTGGCTGG - Intronic
955180553 3:56665027-56665049 CAGGCATGCACCATCATGTCTGG - Intronic
955262250 3:57404575-57404597 CAGGCATGCGCCGGCATGCCTGG - Intronic
955314208 3:57921846-57921868 CAGGCATGCACAACCATGCCTGG + Intronic
955357187 3:58240871-58240893 CAGGCATGCACAAGCACGCCTGG + Intronic
955507837 3:59649366-59649388 CAGGCATGTTCAGGCATGGCAGG - Intergenic
955596454 3:60595784-60595806 CAGGCATGCACCGCCATGCCTGG + Intronic
955726754 3:61941478-61941500 CAGGCATGCACCGCCATGCCCGG - Intronic
956799326 3:72742765-72742787 CAGGCATGCACCACCATGTCCGG + Intergenic
956815992 3:72908878-72908900 CAGGCATGCACCACCATGTCTGG + Intronic
957056361 3:75445986-75446008 CAGGCATGCATCGCCATGTCTGG + Intergenic
957142984 3:76385135-76385157 CAGGCATGCACCACCATGTCTGG + Intronic
957145732 3:76421581-76421603 CAGGCATGCACCACCATGTCCGG - Intronic
957661026 3:83153791-83153813 CAAGCATGCTCAGTCCTCTCTGG - Intergenic
957730267 3:84125495-84125517 CAAGCATGCACACACCTGGCCGG - Intergenic
959088236 3:101874220-101874242 CAGGCATGCACAACCATGCCTGG - Intergenic
959685462 3:109141127-109141149 CAGGCATGCACAACCATGCCTGG + Intergenic
960000932 3:112731148-112731170 CAGGCATGCACCAGCATGCCTGG - Intergenic
960323234 3:116263393-116263415 CAGGCATGCACCGCCATGCCCGG - Intronic
960394897 3:117124706-117124728 CAGGCATGCACCACCATGTCTGG - Intronic
960796673 3:121495126-121495148 CAGGCATGCACCGCCATGCCTGG - Intronic
960925315 3:122790137-122790159 CAGGCATGCACCAGCATGCCTGG + Intronic
960978248 3:123197689-123197711 CAGGCATGCACCATCCTGCCTGG + Intronic
961298023 3:125902724-125902746 CAGGCATGCATCGCCATGTCTGG - Intergenic
961323831 3:126097969-126097991 CAGGAATCCAGAGGCCTGGCTGG + Intronic
961407993 3:126696593-126696615 CAGGCATGCACCGCCATGCCCGG + Intergenic
961454245 3:127016351-127016373 CAGACATGCACAGCCCTGGGAGG + Intronic
962429557 3:135306728-135306750 CATGCAGGCACAGCCCTGCCAGG - Intergenic
963083792 3:141418249-141418271 CAGCCCTGCACATGCCTGTGGGG + Intronic
963533554 3:146500280-146500302 CAGGCATGCACCCCCATGTCTGG - Intergenic
964216920 3:154295908-154295930 CAGGCATGCACAACCATGTTTGG + Intronic
964294135 3:155214848-155214870 CAGGCATGCACCACCATGTCTGG - Intergenic
964352535 3:155817136-155817158 CAGGCATGCACCAACATGTCCGG + Intergenic
964616113 3:158667643-158667665 CAGGCACACACAGGCATGCCTGG - Intronic
964901145 3:161659959-161659981 CAGGCAGGGACAGGTCAGTCGGG + Intergenic
965036085 3:163439839-163439861 CAGGCATGCACTCTCATGTCCGG - Intergenic
966613156 3:181888407-181888429 CAGGCATGCACGAGCATGCCTGG - Intergenic
966614456 3:181898519-181898541 CAGGCATGCACCACCATGTCTGG + Intergenic
967029937 3:185596476-185596498 CAGGCATGCACCACCATGTCTGG - Intronic
968188255 3:196648621-196648643 CAGGCATGCACCAGCATGCCTGG - Intronic
968381294 4:99094-99116 CAGGCATGCACCACCATGTCTGG + Intergenic
968657186 4:1783695-1783717 CAGGCAAGCCCAGGCCTCTGTGG + Intergenic
968999176 4:3966264-3966286 CAGGCATGCATCGCCATGTCTGG + Intergenic
969299289 4:6288072-6288094 CAGGCATGCACCACCATGTCTGG - Intronic
969754825 4:9142366-9142388 CAGGCATGCATCGCCATGTCTGG - Intergenic
969814726 4:9678650-9678672 CAGGCATGCATCGCCATGTCTGG - Intergenic
969888285 4:10236255-10236277 CAGGCATGCAAAGGGCAGACCGG - Intergenic
969908174 4:10417058-10417080 CAGACATGCACAGCCATGCCTGG - Intergenic
970670144 4:18387278-18387300 CAGGCATGCACCACCATGTCAGG + Intergenic
970696254 4:18681025-18681047 CAGGCATGCACCACCATGTCCGG + Intergenic
971002760 4:22341097-22341119 GATGCATGCACAGACTTGTCAGG + Intergenic
971134451 4:23852844-23852866 CACACATGCATATGCCTGTCTGG - Intronic
971164379 4:24167894-24167916 CAGGCATGCACAACCATGCCTGG + Intergenic
971713198 4:30143726-30143748 CAGGCATGCACAAGGCATTCAGG + Intergenic
971797124 4:31242496-31242518 CAGGCATGCACCACCATGTCTGG - Intergenic
971847537 4:31939797-31939819 CAGGCATGCACCACCCTGCCCGG + Intergenic
972705139 4:41535017-41535039 CAGGCATGCACAACCATGCCTGG - Intronic
973125918 4:46584794-46584816 CAGGCATGCACCACCATGTCCGG + Intergenic
973324170 4:48840872-48840894 CAGGCATGCACCGCCATGCCTGG - Intronic
973979929 4:56299525-56299547 CAGGCATGCACAACCATGCCCGG - Intronic
975662922 4:76705352-76705374 CAGGCATGCACCACCATGTCAGG - Intronic
975730097 4:77329500-77329522 CAGGCATGCACCACCATGTCTGG - Intronic
976225441 4:82792112-82792134 CAGGCATGCACTGCCATGCCTGG - Intronic
976423563 4:84873921-84873943 CAGGCATGCACAGCCACGCCTGG + Intronic
977603968 4:98963623-98963645 CCGACATGAACAGGCATGTCTGG + Intergenic
978417994 4:108498901-108498923 CAGGCATGAAGTGCCCTGTCTGG - Intergenic
978945072 4:114485642-114485664 TAGACATCCACAGGCCTGTGGGG - Intergenic
980062927 4:128151743-128151765 CAGGCATGCACTACCATGTCTGG + Intronic
980065943 4:128188215-128188237 CAGGCATGCACCACCATGTCTGG + Intronic
980805070 4:137802182-137802204 CAGGCATGCACTACCATGTCTGG - Intergenic
980918095 4:139053332-139053354 CAGGCATGCACAACCATGCCTGG - Intronic
981503469 4:145476396-145476418 CAGGCATGCACCAGCATGCCCGG - Intergenic
981651928 4:147069970-147069992 TCGCCATGCACAGGCATGTCAGG - Intergenic
981723095 4:147821041-147821063 CATGCATGTACAGGGCTGGCTGG + Intronic
982028838 4:151278771-151278793 CAGGCATGCACCATCATGTCAGG + Intronic
982165248 4:152608170-152608192 CAGGCATGCACCACCATGTCTGG - Intergenic
982796100 4:159646496-159646518 CAGGCATGCACCACCCTGCCTGG + Intergenic
983138460 4:164117113-164117135 CAGGCATGCACAACCACGTCTGG - Intronic
983421098 4:167518038-167518060 CAGGCATGCACCACCATGTCTGG - Intergenic
983671462 4:170242715-170242737 CAGGCTTGCACTAGCATGTCAGG - Intergenic
983918349 4:173316235-173316257 CAGGCAGGCACATGCCTGGAGGG - Intronic
983987884 4:174082240-174082262 CAGGCATGCACAACCATGCCTGG + Intergenic
984266904 4:177506637-177506659 CAGGCATGCACCGCCATGCCGGG - Intergenic
984574544 4:181432535-181432557 CATGCATGCACACCCCTCTCTGG - Intergenic
984907142 4:184639087-184639109 CAGGCATGCACCACCATGTCTGG + Intronic
985241545 4:187935981-187936003 CAGGCATGCACTACCATGTCTGG + Intergenic
986251973 5:6068405-6068427 CAGGCATGCACCACCATGTCTGG + Intergenic
987053967 5:14173351-14173373 CAGGCATGCACCACCATGTCCGG + Intronic
987784387 5:22480439-22480461 CAGGCATGCACCACCATGTCTGG - Intronic
988737451 5:34036807-34036829 CAGGCATGCACCAGCATGCCTGG - Intronic
989179870 5:38565728-38565750 CAGGCATGCACTGCCATGCCTGG + Intronic
989411319 5:41122657-41122679 CAGGCATGCACATGTCTGTAAGG - Intergenic
989596160 5:43158109-43158131 CAGGCATGCACCGCCATGCCTGG + Intronic
989695511 5:44195869-44195891 CAGGCATGCACCAGCATGCCTGG - Intergenic
991580962 5:68154898-68154920 CAGGCATGCACCACCATGTCTGG - Intergenic
992535642 5:77700060-77700082 CAGGCATGCACCACCATGTCTGG - Intronic
992720758 5:79559209-79559231 CAGGCATGCACCAACATGTCTGG - Intergenic
992978869 5:82145847-82145869 CAGGCATGCACCACCATGTCCGG + Intronic
993715081 5:91268497-91268519 CAGGCATGCACCACCATGTCTGG + Intergenic
994091903 5:95817270-95817292 CAGGCATGCACCGCCATGCCTGG - Intronic
995062182 5:107822959-107822981 CAGGCATGCACAAATATGTCCGG + Intergenic
995160780 5:108978330-108978352 CAGACATGCAAAGGATTGTCAGG - Intronic
995498550 5:112776696-112776718 CAGGCATGCACCACCATGTCTGG - Intronic
995524825 5:113042192-113042214 CAGGCATGCAGTGCCCTGCCCGG - Intronic
996770308 5:127078801-127078823 CAGGCATGCACAACCGTGCCTGG + Intergenic
996988261 5:129595143-129595165 CTGGTATCCACAGGCCTATCAGG - Intronic
997040626 5:130248864-130248886 CAGGCATGCACGGCCATGCCTGG - Intergenic
997528560 5:134568684-134568706 GGGGCATGCACAGCCCTGGCAGG + Intronic
997556101 5:134800088-134800110 CAGGCATGCACCGCCATGCCCGG + Intronic
997703922 5:135929861-135929883 CAGGCATGCACCACCATGTCTGG - Intronic
998015288 5:138726701-138726723 CAGGCATGCACCAGCATGGCTGG + Intronic
998534647 5:142918287-142918309 CAGGCATGCACCACCCCGTCTGG + Intronic
998841351 5:146257957-146257979 CAGGCATGCACCACCATGTCTGG + Intronic
998947954 5:147361285-147361307 CAGGCATGCATAGGCCTTCATGG - Intronic
999158050 5:149472571-149472593 CAGGCACGCAGTGGGCTGTCTGG - Intergenic
999473234 5:151874781-151874803 CAGGCATGCAAAGATCTTTCTGG + Intronic
999734547 5:154503061-154503083 CAGGCCTGCAGAGGCCAGGCAGG + Intergenic
999975044 5:156903932-156903954 CAGGCATGCACCAACATGTCCGG - Intergenic
1000597026 5:163227493-163227515 CAGGCATGCACCAACCTGCCTGG - Intergenic
1001017427 5:168153992-168154014 CAGGAAAGCACAGGCCAGGCTGG + Intronic
1001036105 5:168297481-168297503 CAGGCATGCACCGCCATGCCTGG - Intronic
1001191438 5:169636585-169636607 CAGGCATGCACCAGCATGCCCGG - Intergenic
1001475831 5:172049943-172049965 CAGGCATGCACCACCATGTCTGG + Intronic
1001508980 5:172304349-172304371 CAGGCATGCCCTGCCATGTCTGG - Intergenic
1001631546 5:173179209-173179231 CAGGCATGCACCACCATGTCCGG + Intergenic
1001960811 5:175879461-175879483 CAGACATGCACTGGACTGTCTGG - Intronic
1002085676 5:176773961-176773983 CAGGCACGCACACACCTGTGCGG - Intergenic
1002408872 5:179058229-179058251 CAGGCCTGCACTGGCATGCCTGG + Intergenic
1002675448 5:180908606-180908628 AAGGCCTGGACAGGCTTGTCTGG - Exonic
1002839606 6:894480-894502 GCAGCATGCACAGGCCTGTAGGG - Intergenic
1003691099 6:8354527-8354549 CAGGCATGCACCACCATGTCTGG + Intergenic
1003740318 6:8929686-8929708 CAGGCATGCACAAACATGGCTGG + Intergenic
1004064313 6:12228104-12228126 CAGGCATGCACCACCATGTCAGG + Intergenic
1004337461 6:14777248-14777270 CAGGCATGCACCGCCATGCCCGG - Intergenic
1004704751 6:18114087-18114109 CAGGCATGCACCAGCGTGCCTGG - Intergenic
1004844717 6:19626864-19626886 CAGGCATGCACCACCATGTCTGG - Intergenic
1004906678 6:20243052-20243074 CAGGCATGCACCACCATGTCTGG - Intergenic
1005298995 6:24452631-24452653 CAGGCATGCACCGCCATGCCCGG - Intronic
1005507534 6:26482727-26482749 CAGGCATGCACCACCATGTCTGG - Intergenic
1005979265 6:30823936-30823958 CAGGCATGCACCACCATGTCTGG - Intergenic
1006363149 6:33598652-33598674 CAGGCATGCACCGCCATGCCTGG + Intergenic
1006584203 6:35095412-35095434 TAGGCATGCACCGCCATGTCTGG - Intergenic
1006761556 6:36466522-36466544 CAGGCATGCACCACCATGTCTGG + Intronic
1006780429 6:36628669-36628691 CAGGCATGCACCACCATGTCTGG - Intergenic
1006956312 6:37875799-37875821 CAGGCATGCACAACCATGCCTGG + Intronic
1007188311 6:39992037-39992059 CAGGCATGCACAGCCACGCCTGG + Intergenic
1007745716 6:44041874-44041896 CAGGAAAGCAGGGGCCTGTCTGG - Intergenic
1007921507 6:45614283-45614305 CAGGCATGCACCGCCATGCCTGG + Intronic
1008752027 6:54746557-54746579 CAGGCATGCACCACCATGTCTGG + Intergenic
1009435665 6:63615351-63615373 CAGGCATGCACCACCATGTCTGG + Intergenic
1009794524 6:68450483-68450505 CAGGCATGCACCAGCATGCCTGG + Intergenic
1010439708 6:75879385-75879407 CAGGCATGCACTAGCATGCCTGG + Intronic
1010887034 6:81256565-81256587 CAGGCATGCACCACCATGTCTGG + Intergenic
1012240299 6:96863664-96863686 CAGGAAGGCACAGTACTGTCAGG - Intergenic
1012348909 6:98226828-98226850 CAGGCGTGCACAACCATGTCTGG + Intergenic
1012968658 6:105703162-105703184 CAGGCATGCACTACCATGTCTGG + Intergenic
1013189599 6:107790925-107790947 CAGGCATGCACCACCATGTCTGG - Intronic
1013307734 6:108865123-108865145 CAGGCATGCACAACCATGCCTGG + Intronic
1013456070 6:110330646-110330668 CATGTATGCCCAGGCCAGTCTGG - Intronic
1013551303 6:111210297-111210319 CAGGCAGTCACAGGACAGTCTGG + Intronic
1014270183 6:119327530-119327552 CAGGCATGCACCACCATGTCTGG + Intronic
1014730324 6:125024573-125024595 CAGGCATGCACCGCTATGTCTGG - Intronic
1015308330 6:131735475-131735497 CAGGCATGCACCATCCTGCCTGG - Intronic
1015542578 6:134330537-134330559 CAGGCATGCACAACCATGCCTGG - Intergenic
1015739851 6:136442260-136442282 CAGGCATGCACCACCATGTCCGG - Intronic
1015750640 6:136554949-136554971 CAGGCATGCACCACCATGTCTGG - Intergenic
1016022097 6:139246769-139246791 CAGGCATGCACCACCATGTCCGG - Intronic
1016089113 6:139953862-139953884 CAGGCATGCACCACCATGTCTGG + Intergenic
1016129102 6:140443353-140443375 CAGGCATGCACTGCCATGCCTGG - Intergenic
1016393966 6:143603000-143603022 CAGGCATGCACCACCATGTCTGG - Intronic
1017180282 6:151545775-151545797 CAGGCATGCACCACCATGTCTGG + Intronic
1017195539 6:151696327-151696349 CAGGCATGCACCACCATGTCCGG - Intronic
1017267038 6:152459417-152459439 CAGGAAAGCACAGGCCTGTCTGG - Intronic
1018129393 6:160714478-160714500 CCGGGATGCACAGGCCAGTGGGG - Intronic
1018933874 6:168260720-168260742 CGGGCCTGCACAGGGCTGACCGG + Intergenic
1018974438 6:168554558-168554580 CAGGCCTGCACAGGCCGTTCTGG + Intronic
1019875860 7:3809973-3809995 CAGCCATGCACAGTCCTCCCAGG + Intronic
1020340087 7:7100664-7100686 CAGGCTTGCAGATGCCTGCCCGG - Intergenic
1020569806 7:9845064-9845086 CAGGCATGCACCGCCATGCCTGG - Intergenic
1020807619 7:12809641-12809663 CAGTCATGCACAGACATGTCTGG + Intergenic
1021026341 7:15671948-15671970 CAGGCATGCACGAGCATGCCTGG - Intronic
1021266773 7:18534402-18534424 CAGGCATGCACTGCCATGCCTGG - Intronic
1021395087 7:20138008-20138030 CAGGCATGCACCACCTTGTCCGG - Exonic
1021657087 7:22883045-22883067 CAGGCATGCACTATCATGTCTGG + Intergenic
1022064050 7:26832546-26832568 CAGGCATGCACCAGCATGCCTGG - Intronic
1022436524 7:30391148-30391170 CAGATATGCACAGGCCTTCCAGG - Intronic
1022683324 7:32571087-32571109 CAGGCATGCACCACCATGTCTGG - Intronic
1022706645 7:32807949-32807971 CAGGCATGCACCAGCATGTCCGG + Intergenic
1023114554 7:36849175-36849197 CAGGCATGCACCACCATGTCTGG + Intergenic
1023303457 7:38798433-38798455 CAGGCATGCACCACCATGTCTGG + Intronic
1023413884 7:39914310-39914332 CAGGCATGCACCGCCATGACTGG - Intergenic
1023984373 7:45086351-45086373 GAGTCATGAACAGACCTGTCTGG + Intronic
1024595221 7:50927604-50927626 CAGCCAGGAACATGCCTGTCAGG - Intergenic
1024987487 7:55208187-55208209 CAGGGAGGCACAGTTCTGTCTGG + Exonic
1025064542 7:55841886-55841908 CATGGTGGCACAGGCCTGTCAGG + Intronic
1025094559 7:56087362-56087384 CAGGCATGCACCAGCATGCCTGG + Intronic
1025138834 7:56445636-56445658 CAGGCATGCACAACCATGCCCGG - Intergenic
1025616194 7:63119507-63119529 CAGGCATGCACCACCCTGCCTGG - Intergenic
1025665692 7:63581943-63581965 CAGGCATGCACTGCCATGCCTGG - Intergenic
1025740338 7:64191303-64191325 CAGGCATGCACCACCATGTCTGG + Intronic
1025930130 7:65986817-65986839 CAGGCATGCACCACCATGTCTGG - Intergenic
1026033389 7:66814505-66814527 CAGGCATGCACCAGCATGCCCGG - Intergenic
1026096939 7:67353958-67353980 CAGGCATGCACCACCATGTCCGG + Intergenic
1026192949 7:68146386-68146408 CAGGCATGCACCAGCATGCCCGG + Intergenic
1026262117 7:68764487-68764509 CAGGCATGCACCACCATGTCTGG + Intergenic
1026287919 7:68979825-68979847 CAGGCATGCACCACCATGTCTGG - Intergenic
1026318989 7:69252632-69252654 CAGGCATGCACCACCATGTCTGG + Intergenic
1026336187 7:69395943-69395965 CAGGCATGCACTGCCATGCCTGG + Intergenic
1026358671 7:69582629-69582651 CAGGCATGCACCAACATGTCTGG + Intergenic
1026487135 7:70831099-70831121 CAGGCTTGCACAGGGTGGTCAGG + Intergenic
1026862525 7:73800302-73800324 CAGGCATGCACCGCCCCGCCCGG + Intronic
1027003666 7:74673522-74673544 CAGGCATGCGCAGCCATGCCTGG + Intronic
1028313160 7:89364553-89364575 CAGGCATGCACCACCATGTCTGG + Intergenic
1028764654 7:94539524-94539546 CAGGCATGCACCGCCATGCCTGG - Intronic
1029037964 7:97541510-97541532 CAGGCATGCAGCGGACTGGCGGG + Intergenic
1029162059 7:98559526-98559548 CAGGCATGCACCGCCATGGCTGG + Intergenic
1029425680 7:100492754-100492776 CAAGCATGCACCAGCATGTCTGG - Intronic
1029630294 7:101746044-101746066 CAGGCATGCACTGCCATGCCTGG + Intergenic
1029994446 7:104993288-104993310 CAGGCATGCACAACCATGCCTGG + Intergenic
1030184060 7:106742183-106742205 CAGGCATGCACAATCATGCCCGG + Intergenic
1031410307 7:121433542-121433564 CAGGCATGCACCACCATGTCTGG - Intergenic
1032582916 7:133119917-133119939 CAGGCATGCACTGCCATGCCTGG + Intergenic
1032995084 7:137435920-137435942 CAGGCATGCACCATCATGTCAGG + Intronic
1033083592 7:138321317-138321339 CAGGCATGCACCACCATGTCTGG - Intergenic
1033466110 7:141591233-141591255 CAGGCATGCACCAGCATGCCCGG + Intronic
1034283457 7:149869155-149869177 CAGGCATTCTGAGGCCAGTCTGG + Intergenic
1034464820 7:151220843-151220865 CAGGCATGCACTGCCATGTCTGG - Intronic
1034479733 7:151309984-151310006 CAGGCATGCACCACCATGTCTGG + Intergenic
1034521984 7:151627481-151627503 CAGGCATGCACCAGCATGCCTGG - Intronic
1034650497 7:152686385-152686407 CAGGCATGCACCAGCATGCCCGG + Intergenic
1034767782 7:153742673-153742695 CAGGCATGCACCACCATGTCCGG - Intergenic
1035050318 7:155994968-155994990 CAGGCATGCACCACCATGTCCGG + Intergenic
1035128067 7:156625161-156625183 CAGGCATGCACCACCATGTCTGG - Intergenic
1035369895 7:158372830-158372852 AAGGCATGCATAGTCCTGACAGG + Intronic
1035452899 7:158989887-158989909 CAGGCATGCACAACCATGCCTGG - Intergenic
1035540924 8:437396-437418 CAGAGATGCACAGACCTGTGAGG - Intronic
1035970046 8:4237983-4238005 GAGGCATGCACAGGCCTACTGGG + Intronic
1036378058 8:8217682-8217704 CAGGCATGCATCGCCATGTCTGG - Intergenic
1036490446 8:9220422-9220444 CAGGCATGCACAACCATGCCTGG + Intergenic
1036640744 8:10581981-10582003 CAGGCATGCACAGCCACGCCTGG + Intergenic
1036851507 8:12204935-12204957 CAGGCATGCATCGCCATGTCTGG + Intergenic
1036872872 8:12447209-12447231 CAGGCATGCATCGCCATGTCTGG + Intergenic
1037489022 8:19378937-19378959 CAGGCATGCACCGCCATGCCTGG - Intronic
1038046517 8:23769791-23769813 CAGGCATGCACTGCCATGCCTGG + Intergenic
1038062560 8:23929111-23929133 CAGGCATGCACCACCATGTCTGG + Intergenic
1038323252 8:26548734-26548756 CAGGCATGCACTACCATGTCTGG - Intronic
1038502351 8:28055688-28055710 TAGGCATGCACCGCCATGTCTGG - Intronic
1038745470 8:30250890-30250912 CAGGCATGCACCGCCGTGCCTGG + Intergenic
1039142588 8:34408662-34408684 CAGGCATGCACCACCATGTCTGG + Intergenic
1039193700 8:35006076-35006098 CTGTCATGCACAGGCCAGCCGGG + Intergenic
1039210204 8:35204811-35204833 CAAGCATGCACATGGCTGGCTGG + Intergenic
1040495688 8:47963309-47963331 CAGGCATGCACCACCATGTCTGG - Intronic
1040737210 8:50522719-50522741 CAGGCATGCACCGCCATGCCCGG + Intronic
1042139867 8:65667131-65667153 CAGGCATGCACCACCATGTCCGG - Intronic
1042264071 8:66890661-66890683 CAGGCATGCACTAGCATGTCTGG + Intronic
1042302884 8:67304674-67304696 CAGGCATGCACCGCCATGCCCGG - Intronic
1042457117 8:69018836-69018858 CAGGCATGCACCGTCATGCCTGG + Intergenic
1042520144 8:69702965-69702987 CAGGCATGCACCACCATGTCTGG - Intronic
1042632938 8:70840678-70840700 CGAGGATGCACAGGCCTCTCAGG - Intergenic
1043045667 8:75320813-75320835 CAGGCATGCACAACCATGCCTGG - Intergenic
1043183128 8:77109908-77109930 CAGGCATGCACCACCATGTCTGG + Intergenic
1043252665 8:78094905-78094927 CAGGCATTCATGGGCCTGGCAGG + Intergenic
1043857825 8:85281653-85281675 CAGGCATGCACAAGCATGCCTGG + Exonic
1043890562 8:85648399-85648421 GAGGCATGTACCGGCATGTCCGG - Intergenic
1043893928 8:85722108-85722130 GAGGCATGTACCGGCATGTCCGG + Intergenic
1043894285 8:85725193-85725215 GAGGCATGTACCGGCATGTCCGG + Intergenic
1043894641 8:85728278-85728300 GAGGCATGTACCGGCATGTCCGG + Intergenic
1043894997 8:85731363-85731385 GAGGCATGTACCGGCATGTCCGG + Intergenic
1043897679 8:85750448-85750470 GAGGCATGTACCGGCATGTCCGG - Intergenic
1043898035 8:85753533-85753555 GAGGCATGTACCGGCATGTCCGG - Intergenic
1043898394 8:85756618-85756640 GAGGCATGTACCGGCATGTCCGG - Intergenic
1043900006 8:85768813-85768835 GAGGCATGTACCGGCATGTCCGG - Intergenic
1043901611 8:85781006-85781028 GAGGCATGTACCGGCATGTCCGG - Intergenic
1043901970 8:85784091-85784113 GAGGCATGTACCGGCATGTCCGG - Intergenic
1043903578 8:85796281-85796303 GAGGCATGTACCGGCATGTCCGG - Intergenic
1043905189 8:85808474-85808496 GAGGCATGTACCGGCATGTCCGG - Intergenic
1043906801 8:85820665-85820687 GAGGCATGTACCGGCATGTCCGG - Intergenic
1044034664 8:87285725-87285747 CAGGCATGCACCACCATGTCCGG - Intronic
1044985198 8:97750906-97750928 CAGGCATGCACCACCATGTCCGG - Intergenic
1045382953 8:101644988-101645010 CAGGCATGCACCACCATGTCTGG + Intronic
1045581199 8:103482477-103482499 CAGGCATGCACCACCCTGTCTGG - Intergenic
1045632759 8:104145718-104145740 CAGGCATGCACCACCATGTCCGG - Intronic
1045806824 8:106171839-106171861 CAGGCATGCACCGCCATGGCTGG - Intergenic
1045930813 8:107624456-107624478 CAGGCATGCACAACCATGCCTGG + Intergenic
1046139390 8:110070195-110070217 CAGGCATGCACTGCCATGTTTGG + Intergenic
1046951758 8:120026127-120026149 CAGGCATGCACCACCATGTCCGG + Intronic
1047043922 8:121030526-121030548 CAGGCATGCACCACCATGTCTGG - Intergenic
1047166978 8:122450191-122450213 CAGGCATGCACAATCATGCCTGG + Intergenic
1047213799 8:122860888-122860910 CAGGCATGCACTGCCATGCCCGG - Intronic
1047849669 8:128843024-128843046 CAGGCATGCACAACCATGCCTGG + Intergenic
1048119347 8:131562788-131562810 CAGGCATGCACCACCATGTCCGG - Intergenic
1049168144 8:141139773-141139795 CAGGCATGCCCACGCCAGGCCGG - Intronic
1049246036 8:141563123-141563145 CACACATGCACAGGCATGCCCGG + Intergenic
1049373347 8:142278049-142278071 CTGGCCTGCACAGGCCTGAGAGG + Intronic
1049590307 8:143456723-143456745 CAGGCATGCACCACCATGTCTGG - Intronic
1049687864 8:143946159-143946181 CCCGGAAGCACAGGCCTGTCCGG - Intronic
1050551148 9:6749523-6749545 CAGGCATGCACCACCATGTCTGG - Intronic
1050855933 9:10355619-10355641 CAGGCATGCACGACCATGTCCGG + Intronic
1051184882 9:14449789-14449811 CAGGCATGCACCACCATGTCTGG - Intergenic
1051442673 9:17102483-17102505 CAGGCATGCACCATCATGTCCGG - Intergenic
1052089221 9:24306983-24307005 CAGGCATGCACTGCCATGCCTGG - Intergenic
1052372534 9:27681728-27681750 CAGGCATGCACTACCGTGTCTGG + Intergenic
1052976816 9:34417187-34417209 CAGGCATGCACAACCATATCTGG + Intronic
1052993965 9:34539801-34539823 CAGGCATGCACCACCATGTCCGG - Intergenic
1053220387 9:36307659-36307681 CAGGCATGCACCACCATGTCTGG - Intergenic
1053657895 9:40238782-40238804 CAGGCATGCACAATCATGCCTGG + Intronic
1053908265 9:42868056-42868078 CAGGCATGCACAATCATGTCTGG + Intergenic
1054370016 9:64385054-64385076 CAGGCATGCACAATCATGCCTGG + Intronic
1054460758 9:65461235-65461257 CAGGCATTGACAGGGCTCTCCGG + Intergenic
1054526701 9:66137443-66137465 CAGGCATGCACAATCATGCCTGG - Intronic
1054677647 9:67874808-67874830 CAGGCATGCACAATCATGCCTGG + Intronic
1056161199 9:83895907-83895929 CAGGCATGCACAACCATGCCTGG - Intronic
1056358932 9:85833352-85833374 CAGGCATGCACAACCATGCCTGG + Intergenic
1056639683 9:88359768-88359790 CAGGCATGCACCACCATGTCTGG + Intergenic
1056654240 9:88496095-88496117 CAGGCATGCACAACCATGCCGGG - Intergenic
1057156780 9:92849116-92849138 CAGGCATGCACCACCATGTCCGG - Intronic
1057908567 9:99001133-99001155 CAGGGATGCACAGGACTGGTGGG + Intronic
1058039754 9:100290851-100290873 CAGGCATGCACTACCATGTCTGG + Intronic
1058994686 9:110288163-110288185 CAGGCATGCAACGCCATGTCTGG - Intergenic
1059071408 9:111141313-111141335 CAGGTATGCACTGCCATGTCTGG - Intergenic
1059107766 9:111525988-111526010 CAGGCGTGGACAGGCCTGAAAGG - Intronic
1059499933 9:114743580-114743602 CAGGCATGCACTGCCATGCCTGG - Intergenic
1061547254 9:131311678-131311700 CAGGCATGCACCACCATGTCTGG - Intergenic
1061680001 9:132238280-132238302 CAGGCAGTCACGGGCTTGTCTGG + Intronic
1062352017 9:136143923-136143945 CCGGCATGCACAGGCTTCCCAGG - Intergenic
1203427253 Un_GL000195v1:52470-52492 CAGGCATGAACAGCCGTGCCTGG + Intergenic
1185597699 X:1317947-1317969 CAGGCATGCACAACCATGACTGG + Intergenic
1185739748 X:2521969-2521991 CAGGCATGCACCAGCATGCCCGG - Intergenic
1185757387 X:2662507-2662529 CAGGCATGCACCATCATGTCTGG - Intergenic
1185989146 X:4873425-4873447 CAGGCATGCACCACCATGTCTGG + Intergenic
1186090052 X:6037161-6037183 CAGGCATGCACCACCATGTCTGG - Intronic
1186287322 X:8059429-8059451 CAGGCATGCACCACCATGTCTGG - Intergenic
1187019150 X:15362009-15362031 CAGGCATGCACCGCCATGCCTGG + Intronic
1187019696 X:15367810-15367832 CAGGCATGCACCAGCATGTCTGG - Intronic
1187419876 X:19124774-19124796 CAGGCATGCACCGCCATGCCTGG - Intergenic
1187427502 X:19191650-19191672 CAGGCATGCACCACCATGTCTGG + Intergenic
1187809844 X:23163584-23163606 CAGGCATGCACCACCCTGTCTGG - Intergenic
1189331843 X:40148953-40148975 CAGGAATGCACAGTCCAGTTAGG + Intronic
1189756385 X:44276021-44276043 CAGTCCTCCACAGGCCTCTCTGG + Intronic
1189791148 X:44606675-44606697 CAGGCATACACTGGCACGTCCGG - Intergenic
1189848972 X:45160348-45160370 CAGGCATGCACTGCCATGCCTGG + Intronic
1189849101 X:45161397-45161419 CAGGCATGCACTGCCATGTCTGG - Intronic
1190186625 X:48240252-48240274 CAGACATGCACAATCCTGCCCGG + Intronic
1190311283 X:49118594-49118616 CAGGCATGCACCAGCATGCCTGG - Intronic
1190875589 X:54458084-54458106 CAGGCATCCACATGCCTTTCAGG + Intronic
1191007040 X:55720707-55720729 CAGGCATGCACCATCATGTCCGG - Intronic
1191734137 X:64371012-64371034 CAGGCATGCACCACCATGTCTGG - Intronic
1191843157 X:65527391-65527413 CAGGCATGCACTACCATGTCTGG - Intronic
1192354613 X:70389111-70389133 CAGGCATGCACCACCATGTCTGG - Intronic
1192391668 X:70735193-70735215 CAGGCATGCACCACCATGTCTGG + Intronic
1192798950 X:74447841-74447863 CAGGCATGCACCATCATGTCTGG - Intronic
1193368004 X:80658054-80658076 CAGGCATGCACCACCATGTCCGG - Intergenic
1193379297 X:80800397-80800419 CAGGCATGCACCGTCATGTCTGG - Intronic
1194710797 X:97234186-97234208 CAGGCATGCACCACCATGTCTGG - Intronic
1196098341 X:111823418-111823440 TAGGCATGCAAAGAGCTGTCTGG + Intronic
1196261834 X:113592207-113592229 CAGGCAAGCACCAGCATGTCTGG + Intergenic
1196647280 X:118131678-118131700 CAGGCATGCACCAACATGTCTGG + Intergenic
1196926383 X:120637442-120637464 CAGGCATGCACCAGCATGCCCGG + Intergenic
1197230691 X:124000531-124000553 CAGGCATGCACCACCATGTCTGG - Intronic
1198470551 X:136942405-136942427 CAGGCATGCACCACCATGTCTGG + Intergenic
1199180154 X:144844841-144844863 CAGGCATGCACCACCATGTCTGG - Intergenic
1199356578 X:146869549-146869571 CAGGCATGCACGGGCGGGGCAGG - Intergenic
1200139536 X:153892370-153892392 CAGTCATGCAAAGGCTTGGCTGG - Intronic
1201057301 Y:10008067-10008089 CAGGCATGCACCACCATGTCTGG + Intergenic
1201581965 Y:15519130-15519152 CAGGCATGCACCGCCATGACTGG + Intergenic