ID: 1070605968

View in Genome Browser
Species Human (GRCh38)
Location 10:77898738-77898760
Sequence CAGGCATGCACAGGCCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605968_1070605974 -5 Left 1070605968 10:77898738-77898760 CCTGACAGGCCTGTGCATGCCTG No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605968_1070605978 9 Left 1070605968 10:77898738-77898760 CCTGACAGGCCTGTGCATGCCTG No data
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605968_1070605976 0 Left 1070605968 10:77898738-77898760 CCTGACAGGCCTGTGCATGCCTG No data
Right 1070605976 10:77898761-77898783 AGAGGGCCAGGCAGGCGGTAAGG No data
1070605968_1070605973 -8 Left 1070605968 10:77898738-77898760 CCTGACAGGCCTGTGCATGCCTG No data
Right 1070605973 10:77898753-77898775 CATGCCTGAGAGGGCCAGGCAGG No data
1070605968_1070605979 29 Left 1070605968 10:77898738-77898760 CCTGACAGGCCTGTGCATGCCTG No data
Right 1070605979 10:77898790-77898812 AGGAAGCTCCGTGCTGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605968 Original CRISPR CAGGCATGCACAGGCCTGTC AGG (reversed) Intronic