ID: 1070605971

View in Genome Browser
Species Human (GRCh38)
Location 10:77898747-77898769
Sequence TGGCCCTCTCAGGCATGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605971_1070605979 20 Left 1070605971 10:77898747-77898769 CCTGTGCATGCCTGAGAGGGCCA No data
Right 1070605979 10:77898790-77898812 AGGAAGCTCCGTGCTGTGCAAGG No data
1070605971_1070605978 0 Left 1070605971 10:77898747-77898769 CCTGTGCATGCCTGAGAGGGCCA No data
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605971_1070605976 -9 Left 1070605971 10:77898747-77898769 CCTGTGCATGCCTGAGAGGGCCA No data
Right 1070605976 10:77898761-77898783 AGAGGGCCAGGCAGGCGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605971 Original CRISPR TGGCCCTCTCAGGCATGCAC AGG (reversed) Intronic