ID: 1070605971

View in Genome Browser
Species Human (GRCh38)
Location 10:77898747-77898769
Sequence TGGCCCTCTCAGGCATGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 292}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605971_1070605978 0 Left 1070605971 10:77898747-77898769 CCTGTGCATGCCTGAGAGGGCCA 0: 1
1: 0
2: 2
3: 21
4: 292
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605971_1070605979 20 Left 1070605971 10:77898747-77898769 CCTGTGCATGCCTGAGAGGGCCA 0: 1
1: 0
2: 2
3: 21
4: 292
Right 1070605979 10:77898790-77898812 AGGAAGCTCCGTGCTGTGCAAGG No data
1070605971_1070605976 -9 Left 1070605971 10:77898747-77898769 CCTGTGCATGCCTGAGAGGGCCA 0: 1
1: 0
2: 2
3: 21
4: 292
Right 1070605976 10:77898761-77898783 AGAGGGCCAGGCAGGCGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605971 Original CRISPR TGGCCCTCTCAGGCATGCAC AGG (reversed) Intronic
900569700 1:3352206-3352228 TGGCCCTCTCTGCCATGGGCTGG + Intronic
900616310 1:3567214-3567236 GGTCCCTCCCAGGGATGCACTGG + Intronic
902211426 1:14907544-14907566 TGGCCCTCTTAGGCATCCAAGGG - Intronic
902544837 1:17183797-17183819 AGGCCCACTCAGGCCTGCATGGG - Intergenic
904044554 1:27602107-27602129 TGGCCCTGCCAGTCAGGCACTGG + Intronic
904477407 1:30774163-30774185 AGGACCTCTCCAGCATGCACCGG - Intergenic
904909915 1:33927099-33927121 TGGTGCTCTCAGTCTTGCACTGG - Intronic
905884413 1:41484194-41484216 TGGCCCTTCCCTGCATGCACAGG + Exonic
907582514 1:55584804-55584826 TGGCCCCATCAGGGATGCTCTGG + Intergenic
908237808 1:62164251-62164273 TGGCCCTTTCATGCATGTGCAGG + Intergenic
910730436 1:90389977-90389999 TGGCCCTCAGAGGCAAGAACTGG - Intergenic
912334953 1:108853600-108853622 TGCCCTTCTCAGACATGCAAGGG - Intronic
914208722 1:145559085-145559107 TGACCCTCTGAGCCAGGCACGGG + Intergenic
916580236 1:166100547-166100569 GGGCCCTCTGAGCCATGCATGGG - Intronic
917252127 1:173074289-173074311 GGGCCCTCTGAGCCATGCGCAGG - Intergenic
918120637 1:181536776-181536798 TGTTCCTCTCAGGCATGGAAAGG + Intronic
918944813 1:191049810-191049832 TGCCTCTCTCATGCCTGCACCGG + Intergenic
922321781 1:224495064-224495086 TAGGCCTCTAAGGCATGAACTGG - Intronic
922745357 1:228040050-228040072 TGTCCCCCTCAGCCATGCAGTGG + Intronic
923407921 1:233681060-233681082 TGGCCCACCCAGTGATGCACAGG + Intergenic
924704804 1:246491788-246491810 AGGCCCTCACAGGGAGGCACTGG + Intronic
1063062188 10:2567625-2567647 TGGCCCACTCAGCCACCCACAGG - Intergenic
1065376766 10:25051016-25051038 TGTACCTATAAGGCATGCACGGG - Intronic
1070509430 10:77146998-77147020 TGGCCCCCTCTGCCATGCCCAGG - Intronic
1070605971 10:77898747-77898769 TGGCCCTCTCAGGCATGCACAGG - Intronic
1073142142 10:101255186-101255208 TTGTCCTCTCAGGGATGCATAGG - Intergenic
1073971382 10:109048039-109048061 TGGCACTCGCAGGCCGGCACGGG + Intergenic
1074521339 10:114227441-114227463 CGGCCCTCCCAGGCAGCCACAGG - Intronic
1074708335 10:116155974-116155996 TGGGCCACTCAGGCCTGCACGGG - Intronic
1076241455 10:128911411-128911433 GTGTCCTCTCAGGCAAGCACAGG - Intergenic
1076313861 10:129527167-129527189 TCTGCCTCTCAGGCTTGCACAGG - Intronic
1076919386 10:133443601-133443623 AGGCACACACAGGCATGCACAGG + Intergenic
1077195954 11:1280261-1280283 TGGCCCTCTCTGGAACTCACAGG + Intronic
1077302905 11:1855362-1855384 TGGCACTCTGTGACATGCACGGG - Intronic
1078133677 11:8634926-8634948 TGGCACTCACAGGCCAGCACAGG + Intronic
1078763024 11:14266849-14266871 TGGTCCTCCCAGACATGCATAGG + Exonic
1078819910 11:14868243-14868265 TGGCCCTATCGTGCATGCACAGG - Intronic
1082754716 11:57063093-57063115 GGGCCCTCTGAGCCAGGCACGGG - Intergenic
1083226412 11:61287662-61287684 TGGCCCAGGCAGGCATGCCCTGG + Intronic
1084119858 11:67062683-67062705 TGGCCCTCTGAGTCAGGCCCTGG - Intronic
1084431116 11:69111951-69111973 TGGACCTCCCATCCATGCACAGG - Intergenic
1084470907 11:69358544-69358566 AGGGCCTCTCAGGCTGGCACTGG - Intronic
1084600810 11:70144403-70144425 AGACCCTCTCAGGCAGGCACTGG + Intronic
1085731924 11:79007479-79007501 TGGCTGTGTCAGGCATCCACTGG + Intronic
1088991067 11:114954078-114954100 TGACCCCCTCAGCCATGGACAGG + Intergenic
1089093256 11:115896536-115896558 TGGGCCTCCCAGGCTTGCAGCGG - Intergenic
1091275448 11:134346446-134346468 TGCCCCTCTCATGCATGGCCAGG - Intronic
1091781774 12:3218503-3218525 TGGCCTTCTCAGGCAAGCCTGGG + Intronic
1092171224 12:6375082-6375104 TGGCCCTATCAGGGAAGCAGAGG - Exonic
1093344472 12:18024153-18024175 GGACCCTCTGAGCCATGCACGGG - Intergenic
1094207673 12:27857943-27857965 TGGCTTTCTCAGCCTTGCACTGG - Intergenic
1100563822 12:95775536-95775558 GGACCCTCTGAGCCATGCACGGG - Intronic
1101735442 12:107459772-107459794 TGGCACACACAGCCATGCACAGG + Intronic
1102540771 12:113617641-113617663 TTGCTGTCTCAGGCATGCAGTGG + Intergenic
1105407750 13:20145775-20145797 TGGCCATCTCAGGCCTACACCGG + Intronic
1108410427 13:50140938-50140960 TGGCCATCACATGCTTGCACCGG - Intronic
1109809258 13:67489419-67489441 TGGACCTCTCAGGATTGCACTGG + Intergenic
1111456893 13:88496163-88496185 TTGCCCTGTCTGGCATTCACTGG + Intergenic
1113124768 13:106964972-106964994 TGCCTCTCTCAGGAAAGCACTGG - Intergenic
1114035068 14:18616676-18616698 TGGCCTTGTCTGGCATGCACAGG - Intergenic
1114059842 14:19008737-19008759 TCGGCCTCCCTGGCATGCACAGG + Intergenic
1114060035 14:19009902-19009924 TTGGCCTCCCTGGCATGCACAGG + Intergenic
1114060225 14:19011089-19011111 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1114060330 14:19011673-19011695 TTGGCCTCCCTGGCATGCACAGG + Intergenic
1114060652 14:19013651-19013673 TCGGCCTCCCTGGCATGCACAGG + Intergenic
1114060847 14:19014814-19014836 TTGGCCTCCCTGGCATGCACAGG + Intergenic
1114061150 14:19016645-19016667 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1114101104 14:19383334-19383356 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1114101408 14:19385165-19385187 TTGGCCTCCCTGGCATGCACAGG - Intergenic
1114101603 14:19386327-19386349 TCGGCCTCCCTGGCATGCACAGG - Intergenic
1114102022 14:19388933-19388955 TTGGCCTCCCTGGCATGCACAGG - Intergenic
1114102215 14:19390077-19390099 TCGGCCTCCCTGGCATGCACAGG - Intergenic
1114102512 14:19391870-19391892 TTGGCCTCCCTGGCATGCACAGG - Intergenic
1114102705 14:19393014-19393036 TCGGCCTCCCTGGCATGCACAGG - Intergenic
1114123577 14:19698340-19698362 TGGCCTTGTCTGGCATGCACAGG + Intergenic
1115887691 14:37992088-37992110 TGTCCCCATCAGGCAAGCACAGG + Intronic
1122428138 14:101623490-101623512 AGCGCCTCTCAGGCCTGCACTGG - Intergenic
1202837039 14_GL000009v2_random:86009-86031 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1202906620 14_GL000194v1_random:77366-77388 TGGCCTTGTCTGGCATGCATAGG - Intergenic
1202906724 14_GL000194v1_random:78000-78022 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1123552879 15:21399305-21399327 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1123589016 15:21836052-21836074 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1123589125 15:21836693-21836715 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1128648491 15:69393981-69394003 TGGCCTGCTCATGCCTGCACAGG + Intronic
1129464371 15:75715739-75715761 TGGGCCTCTCTGGCATCCTCAGG + Intergenic
1129720874 15:77877273-77877295 TGGGCCTCTCTGGCATCCTCAGG - Intergenic
1130514796 15:84617999-84618021 TGCCCCTCTCAGGCAGGACCTGG - Intronic
1131555587 15:93395741-93395763 GGACCCTCCCAGCCATGCACAGG + Intergenic
1202961120 15_KI270727v1_random:125884-125906 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1202961228 15_KI270727v1_random:126525-126547 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1134079720 16:11316434-11316456 TGGCCCTGTGAGGCAGGGACAGG - Intronic
1135585369 16:23666336-23666358 TGCCCCTCTCAGGTATCCCCAGG - Intronic
1136508704 16:30722788-30722810 TGGTCCTTCCAGGCATGCGCTGG + Intronic
1137023702 16:35453838-35453860 TGGCCCACTCAGGCTGGCAGGGG + Intergenic
1137025324 16:35468379-35468401 AGGCTTTCCCAGGCATGCACAGG - Intergenic
1137317942 16:47347399-47347421 AGACCCTCCCAGCCATGCACAGG - Intronic
1137481255 16:48853544-48853566 TGGGCCTCTAACCCATGCACTGG + Intergenic
1137757064 16:50910825-50910847 CAGCCCTCTCAGGCTTGCCCCGG - Intergenic
1142024630 16:87805928-87805950 TGGCCTTCTCAGACTTCCACTGG - Intergenic
1142074029 16:88107078-88107100 CGGCTCTCTCAGGCCCGCACGGG + Intronic
1143381553 17:6499339-6499361 TGGGCCTCTCAGGCATGCGCAGG - Intronic
1144356147 17:14448264-14448286 TGGCCCTCTTTGGCATGTAAAGG + Intergenic
1144740026 17:17576575-17576597 TGGCCTTCTCATGCATGAAGTGG - Intronic
1149337655 17:55653262-55653284 TGGCACACTCAGGCATGCTGAGG + Intergenic
1150533804 17:66014219-66014241 TGGCCCCCACTGACATGCACTGG - Intronic
1152648653 17:81481912-81481934 TGCCCCTCTCAGGCAAGATCGGG - Intergenic
1153813411 18:8771943-8771965 TGGCTCTCTGAGGCATCCAGAGG + Intronic
1154213109 18:12396703-12396725 AGGCCCTCGCAGGCAGGCATGGG - Intergenic
1154453472 18:14500780-14500802 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1154453683 18:14502061-14502083 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1158534112 18:58292122-58292144 GTGCCCTCTGAGGCGTGCACTGG + Intronic
1159026136 18:63183541-63183563 TGGCCCTCTGAGGTACCCACGGG - Intronic
1159801056 18:72899624-72899646 TGGCCGTTTCAAGCCTGCACAGG + Intergenic
1160013719 18:75125506-75125528 TGGCCCTCCCAGGCCAGCCCAGG - Intergenic
1162958846 19:14114438-14114460 TGGCCGTCTTAGGCATCCATAGG + Intronic
1163424690 19:17235068-17235090 TGGCCCCCTCAGGCCCCCACTGG - Intronic
1164265588 19:23613752-23613774 GGACCCTCTGAGCCATGCACAGG - Intronic
1164476195 19:28577821-28577843 CGGCCCCCTCTGGCATGCAGTGG + Intergenic
1164789592 19:30964808-30964830 TGACCCTATCAGCCATGCCCAGG + Intergenic
1168320054 19:55503747-55503769 TGGGCCTCTCAGGAGGGCACAGG - Intronic
1202635596 1_KI270706v1_random:41341-41363 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1202639296 1_KI270706v1_random:68254-68276 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1202649669 1_KI270706v1_random:169168-169190 TGGCCTTGACTGGCATGCACAGG - Intergenic
1202649802 1_KI270706v1_random:169984-170006 TGGCCTTGCCTGGCATGCACAGG - Intergenic
927877452 2:26668261-26668283 TGGATCACTCAGGCATGCAGTGG + Intergenic
931257196 2:60584073-60584095 TGAACCTCTGAGGCATGAACAGG + Intergenic
931264712 2:60650422-60650444 TGGCCCTGGGAGGCATGGACTGG - Intergenic
932323939 2:70842519-70842541 GGGCCCTCTGAGCCAGGCACAGG - Intergenic
933593872 2:84262710-84262732 GGACCCTCTGAGCCATGCACGGG - Intergenic
934494697 2:94787397-94787419 TGGCCTTGCCTGGCATGCACAGG - Intergenic
934717216 2:96551009-96551031 TGGCACTTTCAGGCCTGCCCAGG - Intronic
934808057 2:97254307-97254329 TGACCCTCTCTGGCATTCTCGGG - Intronic
934829453 2:97502880-97502902 TGACCCTCTCTGGCATTCTCGGG + Intronic
935332713 2:101988771-101988793 CTGCCCTCTCATGCATGCTCTGG + Intergenic
935545511 2:104395967-104395989 TCACCCTTCCAGGCATGCACTGG + Intergenic
935794443 2:106627872-106627894 AGGCCCCCTCATGCCTGCACAGG - Intergenic
937905629 2:127051500-127051522 TGGCACTCTGGGGCTTGCACTGG - Intronic
937997972 2:127709407-127709429 GGGCCCTCTCTGGGGTGCACCGG - Intronic
938276184 2:130026177-130026199 TGGCCTTGCCTGGCATGCACAGG + Intergenic
938280420 2:130060087-130060109 TGGCCTTCCCGGACATGCACAGG + Intergenic
938280509 2:130060647-130060669 TTGGCCTCCCTGGCATGCACAGG - Intergenic
938280705 2:130061796-130061818 TGGCCCTGCCTGGCATGCATAGG + Intergenic
938280812 2:130062427-130062449 TGGCCCTGCCTGGCATGCATAGG + Intergenic
938281136 2:130064417-130064439 TGGCCTTCCCGGACATGCACAGG + Intergenic
938281226 2:130064977-130064999 TTGGCCTCCCTGGCATGCACAGG - Intergenic
938281435 2:130066231-130066253 TGGCCTTGCCTGGCATGCACAGG + Intergenic
938281575 2:130067161-130067183 TGGCCTTCCCGGACATGCACAGG + Intergenic
938281702 2:130067971-130067993 TGGCCTTCCCTGGCATGCACAGG + Intergenic
938327143 2:130416933-130416955 TGGCCTTGTCTGGCATGCACAGG + Intergenic
938331243 2:130449986-130450008 TGGCCTTGCCTGGCATGCACAGG + Intergenic
938331349 2:130450626-130450648 TGGCCTTGCCTGGCATGCACAGG + Intergenic
938331456 2:130451264-130451286 TGGCCCTGCCTGGCATGCATAGG + Intergenic
938331547 2:130451826-130451848 TTGGCCTCCCTGGCATGCACAGG - Intergenic
938331755 2:130453075-130453097 TGGCCTTGCCTGGCATGCACAGG + Intergenic
938331860 2:130453713-130453735 TGGCCCTGCCTGGCATGCACAGG + Intergenic
938332003 2:130454529-130454551 TGGCCTTGCCTGGCATGCACAGG + Intergenic
938332324 2:130456520-130456542 TGGCCTTCCCTGGCATGCACAGG + Intergenic
938357483 2:130664148-130664170 TGGCCTTGTCTGGCATGCACAGG - Intergenic
938357914 2:130666750-130666772 TTGGCCTCCCTGGCATGCACAGG + Intergenic
938358009 2:130667310-130667332 TGGCCTTGCCTGGCATGCACAGG - Intergenic
938358145 2:130668126-130668148 TGGCCTTGTCTGGCATGCATAGG - Intergenic
938358402 2:130669680-130669702 TTGGCCTCCCTGGCATGCACAGG + Intergenic
938358603 2:130670877-130670899 TGGCCTTGCCTGGCATGCACAGG - Intergenic
938358710 2:130671517-130671539 TGGCCTTGCCTGGCATGCACAGG - Intergenic
938362795 2:130704544-130704566 TGGCCTTGTCTGGCATGCACAGG - Intergenic
938433919 2:131270935-131270957 TGGCCTTCCCTGGCATGCACAGG - Intronic
938434047 2:131271750-131271772 TGGCCTTGCCTGGCATGCACAGG - Intronic
938434152 2:131272364-131272386 TTGGCCTCCCTGGCATGCACAGG + Intronic
938434474 2:131274353-131274375 TTGGCCTCCCTGGCATGCACAGG + Intronic
938434888 2:131276905-131276927 TGGCCCTGCCTGGCATGCATAGG - Intronic
938434991 2:131277543-131277565 TGGCCTTTCCTGGCATGCACAGG - Intronic
938478093 2:131634350-131634372 TTGGCCTCCCTGGCATGCACAGG + Intergenic
938478309 2:131635733-131635755 TGGCCTTGCCTGGCATGCACAGG - Intergenic
938478523 2:131637006-131637028 TGGCCTTGCCTGGCATGCACAGG - Intergenic
943500088 2:188677345-188677367 TGGACCTATCAGGAATGCATTGG + Intergenic
943860283 2:192853460-192853482 TTGCCGTGTCAGGCATCCACTGG + Intergenic
945450276 2:209986416-209986438 TGGCCCTCTCTGGTAGGCTCAGG + Intronic
946513683 2:220388014-220388036 GGACCCTCTGAGCCATGCACAGG + Intergenic
947941702 2:234062185-234062207 TTACCCTATCAGGCAGGCACTGG + Intronic
948289668 2:236815925-236815947 TGGCCTTCTCTGCCAAGCACAGG + Intergenic
1171881455 20:30620663-30620685 TGGCCTTGACTGGCATGCACAGG + Intergenic
1171881565 20:30621282-30621304 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1171881818 20:30622737-30622759 TGGCCTTGACTGGCATGCACAGG + Intergenic
1171971749 20:31569269-31569291 GGGCCCACACAGGCGTGCACCGG + Exonic
1172357908 20:34292489-34292511 TCGCCCTTCCAGGCATACACTGG + Exonic
1173867805 20:46323669-46323691 TGGCCCTGTCAGGGAGTCACTGG - Intergenic
1174277483 20:49414436-49414458 TCAGCCTCTCAGGCAGGCACTGG + Intronic
1176091961 20:63322178-63322200 CTGCACTCTCAGGAATGCACTGG - Intronic
1176602018 21:8802563-8802585 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1176602154 21:8803379-8803401 TGGCCTTGACTGGCATGCACAGG + Intergenic
1176626074 21:9092799-9092821 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1176717791 21:10368144-10368166 GGGCCCTCTCTGGCATTCCCAGG - Intergenic
1176820393 21:13650603-13650625 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1176820498 21:13651244-13651266 TGGCCTTGACTGGCATGCACAGG - Intergenic
1176820710 21:13652525-13652547 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1176850116 21:13906823-13906845 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1179625064 21:42644647-42644669 TGGACCTCTCAGGCCGGCCCTGG - Intergenic
1179715931 21:43288460-43288482 TGCCCCTCACAAGCATGAACTGG + Intergenic
1180299018 22:11021050-11021072 GGGCCCTCTCTGGCATTCCCAGG - Intergenic
1180344302 22:11694114-11694136 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1180344439 22:11694930-11694952 TGGCCTTGACTGGCATGCACAGG + Intergenic
1180362651 22:11913610-11913632 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1180365114 22:11931885-11931907 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1180459188 22:15543722-15543744 TGGCCTTGTCTGGCATGCACAGG - Intergenic
1180478321 22:15731349-15731371 TCGGCCTCCCTGGCATGCACAGG + Intergenic
1180478516 22:15732514-15732536 TTGGCCTCCCTGGCATGCACAGG + Intergenic
1180478704 22:15733701-15733723 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1180478808 22:15734285-15734307 TTGGCCTCCCTGGCATGCACAGG + Intergenic
1180479135 22:15736263-15736285 TCGGCCTCCCTGGCATGCACAGG + Intergenic
1180479330 22:15737426-15737448 TTGGCCTCCCTGGCATGCACAGG + Intergenic
1180479635 22:15739257-15739279 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1182442814 22:30374047-30374069 TGGCCTTCCCAGACCTGCACAGG + Exonic
1183649163 22:39144503-39144525 TGGCCCGCTCAGGCCCGCCCGGG + Intronic
1185162294 22:49237231-49237253 CGGCCCTGTCAGGCGTTCACAGG + Intergenic
950078064 3:10201392-10201414 CGGCCCTCGCAGCCATGCAGTGG + Intronic
950505060 3:13389401-13389423 TGGCCCTCAGAGGCAGGCACGGG + Intronic
952170029 3:30797143-30797165 TGGCCATCTCAAGAATGCGCTGG + Intronic
952992576 3:38844568-38844590 AGGCCCTCCCAGTCCTGCACAGG + Intergenic
955268933 3:57477279-57477301 GGACCCTCTGAGCCATGCACAGG - Intronic
956207411 3:66769443-66769465 GGACCCTCTAAGCCATGCACGGG + Intergenic
959617990 3:108369667-108369689 GGACCCTCTGAGTCATGCACAGG - Intronic
962931429 3:140041269-140041291 TGGCCATCTCAGCCATGAGCTGG - Intronic
963380463 3:144523560-144523582 TGGCCCCTCCAGGCAGGCACTGG + Intergenic
964568869 3:158090409-158090431 GGGCCCTTTTAGGCAAGCACTGG + Intergenic
965271061 3:166617778-166617800 GGACCCTCTGAGTCATGCACGGG - Intergenic
966470390 3:180282499-180282521 TGGCCCTCTCAGCCAAGTGCTGG + Intergenic
970228197 4:13881440-13881462 TGGATCTCTCATGCATGCTCTGG + Intergenic
970603434 4:17658367-17658389 TGGCCTTCTCCAGCATGCGCAGG + Exonic
971670513 4:29549533-29549555 TGGCCATCCCAGGCATCCTCTGG + Intergenic
971798971 4:31263605-31263627 TGGCTCTCTCAGGCAGCTACTGG + Intergenic
973365232 4:49203734-49203756 TGGCCTTGCCTGGCATGCACAGG + Intergenic
973365343 4:49204370-49204392 TGGCCTTGCCTGGCATGCACAGG + Intergenic
973365479 4:49205186-49205208 TGGCCTTGACTGGCATGCACAGG + Intergenic
973395115 4:49587268-49587290 TGGCCTTGACTGGCATGCACAGG - Intergenic
973395247 4:49588084-49588106 TGGCCTTGCCTGGCATGCACAGG - Intergenic
973395359 4:49588720-49588742 TGGCCTTGCCTGGCATGCACAGG - Intergenic
973648140 4:52970372-52970394 GGACCCTCTGAGCCATGCACAGG - Intronic
973874730 4:55206244-55206266 CGACCCTCTGAGCCATGCACAGG - Intergenic
974654324 4:64799805-64799827 TGGCCCACTGAGCCAGGCACAGG - Intergenic
975752044 4:77533820-77533842 GGACCCTCTGAGCCATGCACGGG + Intronic
975922683 4:79411571-79411593 TGGCTCTCTAAAACATGCACAGG - Intergenic
977775660 4:100916518-100916540 GGACCCTCTGAGCCATGCACAGG - Intergenic
978809058 4:112830839-112830861 TGGCACTCGCAGGCCAGCACGGG + Intronic
979989320 4:127355871-127355893 TGGCCCTGTCAGCCCTGCCCTGG + Intergenic
982619926 4:157691837-157691859 GGACCCTCTGAGTCATGCACGGG - Intergenic
1202762614 4_GL000008v2_random:125361-125383 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1202766649 4_GL000008v2_random:154124-154146 TGGCCTTGCCTGGCATGCACAGG + Intergenic
985674525 5:1224128-1224150 AGGCCCTGCCAGGCGTGCACAGG + Exonic
989768776 5:45117584-45117606 GGACCCTCTGAGTCATGCACGGG + Intergenic
990860396 5:60320268-60320290 GGACCCTCTGAGCCATGCACGGG + Intronic
992888460 5:81182325-81182347 AGGCCCACTCATGCATGCAGGGG - Intronic
995742799 5:115372768-115372790 TTGCCCTCTGTGGCCTGCACAGG + Intergenic
995905476 5:117117571-117117593 GGACCCTCTGAGCCATGCACGGG + Intergenic
996207171 5:120755321-120755343 TGACCCTGTCAGGCAGGTACTGG + Intergenic
999090660 5:148933170-148933192 TGGCCCTCTCATGCTTTCCCAGG - Intronic
999149430 5:149417027-149417049 TGGGCCTCCCAGGAAAGCACTGG - Intergenic
1000342395 5:160287822-160287844 TGGCCCTGCCAGGCATGCTGAGG - Intronic
1002306836 5:178288519-178288541 TGGCCCTCTGAGGCAGGAAAGGG - Intronic
1002836102 6:866450-866472 TGGCCCTCCCTGGCTTGCCCGGG + Intergenic
1004638238 6:17489027-17489049 TGGCCCACTCCGGCAAACACAGG + Intronic
1006389974 6:33752431-33752453 TGGCAGGCTCAGGCATGCCCTGG - Intergenic
1008381131 6:50840910-50840932 TGGCCGGCTCAGGCCTGCAGTGG + Intronic
1008572840 6:52831467-52831489 TGACATTCTCAGGTATGCACAGG - Intergenic
1008877449 6:56345054-56345076 TGGACCTCTGTGGGATGCACAGG + Intronic
1009905526 6:69866674-69866696 TTGCCCTCTCACACATGCCCGGG + Intronic
1013584660 6:111567429-111567451 TCGCCCTCTTGGACATGCACAGG - Intronic
1015582510 6:134741280-134741302 TGGCCATCTGAGGCAGGCAGCGG - Intergenic
1017908086 6:158770430-158770452 TGGCCCTGTCAGTCATGGGCTGG + Intronic
1018933870 6:168260711-168260733 CAGCCCTCTCGGGCCTGCACAGG + Intergenic
1020106768 7:5425837-5425859 TGGCCGTCCCGGGGATGCACCGG - Intergenic
1026026522 7:66749060-66749082 TGCCCCTGTCAGACATACACTGG - Intronic
1027465145 7:78505968-78505990 AGGCTCTATCAGGCATGCTCAGG + Intronic
1030452604 7:109731390-109731412 TGGAGATCTCAGGCATGCCCTGG + Intergenic
1034371885 7:150605938-150605960 GGACCCTCTGAGCCATGCACGGG - Intergenic
1034882618 7:154774096-154774118 TGCCCCTCTCAGCCCTGCATGGG + Intronic
1035882255 8:3255654-3255676 GGACCCTCTGAGCCATGCACGGG + Intronic
1035886229 8:3294606-3294628 GGACCCTCTGAGTCATGCACGGG + Intronic
1039719186 8:40143983-40144005 TGACCCTCTGAACCATGCACGGG + Intergenic
1040388651 8:46931802-46931824 GGGCCCACTGAGGCAGGCACAGG + Intergenic
1042124607 8:65525452-65525474 TGACTCTCTCATGCATGCATTGG - Intergenic
1042659330 8:71136103-71136125 TGGCACTGTCAGGCATCCAGTGG + Intergenic
1046612530 8:116441944-116441966 TGGCCCTCAAAGGCATGGTCTGG - Intergenic
1047773646 8:128050567-128050589 TGGATCTCTCAGGCATCCAAGGG - Intergenic
1050388055 9:5111322-5111344 TGTCCCCCTCAGGCATGAAGGGG + Intronic
1051918616 9:22237131-22237153 TCAGGCTCTCAGGCATGCACAGG + Intergenic
1052098057 9:24408809-24408831 GGGCCCTCTGAGCCAGGCACGGG - Intergenic
1052877169 9:33575735-33575757 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1052877236 9:33576051-33576073 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1053498766 9:38568343-38568365 TGGCCTTGCCTGGCATGCACAGG - Intronic
1053498833 9:38568659-38568681 TGGCCTTGCCTGGCATGCACAGG + Intronic
1057161822 9:92894641-92894663 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1057161883 9:92894957-92894979 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1057678218 9:97152836-97152858 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1057678285 9:97153152-97153174 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1058312364 9:103519760-103519782 TATCCATTTCAGGCATGCACTGG + Intergenic
1059328121 9:113517154-113517176 TGGTCCTGTGAGGCATGAACAGG + Intronic
1061258178 9:129464924-129464946 TGCCCCTCTCTGGCATGGAGTGG - Intergenic
1061625946 9:131840718-131840740 AGACCCTCTCAGGGAAGCACCGG - Intergenic
1203526646 Un_GL000213v1:97040-97062 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1203526752 Un_GL000213v1:97677-97699 TGGCCTTGACTGGCATGCACAGG + Intergenic
1203526857 Un_GL000213v1:98318-98340 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1203543375 Un_KI270743v1:110242-110264 TGGCCTTGCCTGGCATGCACAGG + Intergenic
1203543681 Un_KI270743v1:112102-112124 TGGCCTTGCCTGGCATGCACAGG - Intergenic
1185542685 X:916053-916075 GGGCCCTCTCTGGCATTCTCAGG + Intergenic
1187410441 X:19046293-19046315 TGGCCCTCTAAAGCATGCCCTGG + Intronic
1187615059 X:20984108-20984130 TGGCCCTAACAGGCATCTACAGG + Intergenic
1190608629 X:52171118-52171140 AGGCCCTCCAAGCCATGCACGGG - Intergenic
1190641424 X:52484542-52484564 TGGCTCTGCCAGGCATGCACAGG - Intergenic
1190646248 X:52528323-52528345 TGGCTCTGCCAGGCATGCACAGG + Intergenic
1191628233 X:63291718-63291740 GGGCCCTCTGAGCCATGCACGGG + Intergenic
1192802543 X:74480269-74480291 GGACCCTCCCAGCCATGCACGGG + Intronic
1192985669 X:76396231-76396253 GGACCCTCCCAGCCATGCACGGG + Intergenic
1193246049 X:79231650-79231672 TGGCCCTCTCAGGCTTGTACAGG + Intergenic
1195587239 X:106578928-106578950 GGACCCTCTGAGCCATGCACGGG + Intergenic
1195957004 X:110342252-110342274 TTGCCATTTCAGGCATCCACTGG + Intronic
1199481744 X:148305503-148305525 GGACCCTCTGAGCCATGCACGGG + Intergenic