ID: 1070605972

View in Genome Browser
Species Human (GRCh38)
Location 10:77898749-77898771
Sequence TGTGCATGCCTGAGAGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605963_1070605972 5 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC 0: 1
1: 1
2: 7
3: 51
4: 440
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605961_1070605972 7 Left 1070605961 10:77898719-77898741 CCCCCTCCATGGCCTGGCTCCTG 0: 1
1: 2
2: 11
3: 86
4: 699
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605967_1070605972 -5 Left 1070605967 10:77898731-77898753 CCTGGCTCCTGACAGGCCTGTGC No data
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605964_1070605972 4 Left 1070605964 10:77898722-77898744 CCTCCATGGCCTGGCTCCTGACA 0: 1
1: 0
2: 3
3: 44
4: 368
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605966_1070605972 1 Left 1070605966 10:77898725-77898747 CCATGGCCTGGCTCCTGACAGGC 0: 1
1: 0
2: 3
3: 44
4: 349
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605959_1070605972 12 Left 1070605959 10:77898714-77898736 CCCTGCCCCCTCCATGGCCTGGC 0: 1
1: 1
2: 4
3: 121
4: 744
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605960_1070605972 11 Left 1070605960 10:77898715-77898737 CCTGCCCCCTCCATGGCCTGGCT 0: 1
1: 1
2: 7
3: 109
4: 703
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605957_1070605972 13 Left 1070605957 10:77898713-77898735 CCCCTGCCCCCTCCATGGCCTGG 0: 1
1: 0
2: 6
3: 87
4: 830
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605962_1070605972 6 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA 0: 1
1: 0
2: 8
3: 48
4: 388
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data
1070605955_1070605972 27 Left 1070605955 10:77898699-77898721 CCTGAGGAAGTGGGCCCCTGCCC 0: 1
1: 0
2: 1
3: 24
4: 274
Right 1070605972 10:77898749-77898771 TGTGCATGCCTGAGAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605972 Original CRISPR TGTGCATGCCTGAGAGGGCC AGG Intronic
No off target data available for this crispr