ID: 1070605974

View in Genome Browser
Species Human (GRCh38)
Location 10:77898756-77898778
Sequence GCCTGAGAGGGCCAGGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605967_1070605974 2 Left 1070605967 10:77898731-77898753 CCTGGCTCCTGACAGGCCTGTGC No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605966_1070605974 8 Left 1070605966 10:77898725-77898747 CCATGGCCTGGCTCCTGACAGGC No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605961_1070605974 14 Left 1070605961 10:77898719-77898741 CCCCCTCCATGGCCTGGCTCCTG No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605957_1070605974 20 Left 1070605957 10:77898713-77898735 CCCCTGCCCCCTCCATGGCCTGG No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605960_1070605974 18 Left 1070605960 10:77898715-77898737 CCTGCCCCCTCCATGGCCTGGCT No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605968_1070605974 -5 Left 1070605968 10:77898738-77898760 CCTGACAGGCCTGTGCATGCCTG No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605964_1070605974 11 Left 1070605964 10:77898722-77898744 CCTCCATGGCCTGGCTCCTGACA No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605962_1070605974 13 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605963_1070605974 12 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data
1070605959_1070605974 19 Left 1070605959 10:77898714-77898736 CCCTGCCCCCTCCATGGCCTGGC No data
Right 1070605974 10:77898756-77898778 GCCTGAGAGGGCCAGGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605974 Original CRISPR GCCTGAGAGGGCCAGGCAGG CGG Intronic