ID: 1070605975

View in Genome Browser
Species Human (GRCh38)
Location 10:77898757-77898779
Sequence ACCGCCTGCCTGGCCCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605975_1070605979 10 Left 1070605975 10:77898757-77898779 CCTGAGAGGGCCAGGCAGGCGGT 0: 1
1: 0
2: 5
3: 22
4: 292
Right 1070605979 10:77898790-77898812 AGGAAGCTCCGTGCTGTGCAAGG No data
1070605975_1070605978 -10 Left 1070605975 10:77898757-77898779 CCTGAGAGGGCCAGGCAGGCGGT 0: 1
1: 0
2: 5
3: 22
4: 292
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605975 Original CRISPR ACCGCCTGCCTGGCCCTCTC AGG (reversed) Intronic
900142901 1:1145928-1145950 ACTGCCTTCCTGGCACCCTCTGG + Intergenic
900177253 1:1296344-1296366 ACCCCCGGCCTGGCCCTCAGGGG + Intronic
900177275 1:1296397-1296419 ACCCCCAGCCTGGCCCTCAGGGG + Intronic
900605501 1:3521846-3521868 ACCCCCTTCCTGGCACTCTCTGG - Intronic
900646346 1:3710372-3710394 ACCACTTGCCTGCCCCTCCCTGG - Intronic
901627576 1:10632637-10632659 AGCGCCTGTCAGGCCCTTTCTGG + Intergenic
902374074 1:16022098-16022120 CCTGCCTGCCTGGCCCTTCCAGG - Intronic
903147938 1:21387390-21387412 GCCGCCTGCCTTGGCCTCCCAGG + Intergenic
903232803 1:21931948-21931970 AGGGCCAGCCTGGCCCACTCAGG + Intronic
903330490 1:22594654-22594676 ACCGCCCACCTGGCGCTCCCTGG + Intronic
903811174 1:26035846-26035868 ACTGCGTGCCTGGCCCTATGAGG + Exonic
904456113 1:30649261-30649283 GCCGCCTCCCTTACCCTCTCTGG + Intergenic
904467127 1:30714797-30714819 ACTGCCTCTCTGGTCCTCTCTGG - Intronic
905699226 1:39999409-39999431 GCCGCCTGCCTTGGCCTCCCAGG + Intergenic
906367701 1:45224476-45224498 GCCGCCTGCCTTGGCCTCCCTGG + Intronic
907223989 1:52927791-52927813 GCCGCCTGCTCGGCCCTCCCAGG + Intronic
907966629 1:59337237-59337259 GCAGCCTGCCTGGGGCTCTCAGG - Intronic
910521222 1:88124376-88124398 ACCTCCTCCCTTGCCTTCTCTGG + Intergenic
912682616 1:111738866-111738888 TCCGTGTGCCTGGCCGTCTCTGG + Intronic
913088130 1:115457918-115457940 ACTGCCAGCCTGGACCTCTTGGG - Intergenic
919904749 1:202070511-202070533 AGGGCCTGCCTGGGCATCTCTGG - Intergenic
920026367 1:203000653-203000675 CCCACCAGCCTGGCCCTCTAGGG + Intergenic
922770027 1:228176668-228176690 CCTGCCTGCTTGGCCCTCTGTGG - Exonic
923251382 1:232182078-232182100 ACCTCCTGTCTGGTCCTGTCTGG - Intergenic
924859609 1:247907673-247907695 TCCGCCTGCCTCGGCCTCCCAGG + Intergenic
1062922382 10:1289829-1289851 AACGCCTACCTGCCCCTCCCTGG - Intronic
1063700335 10:8378349-8378371 ACAGCCTGCCTTTCCCCCTCTGG + Intergenic
1064691675 10:17924873-17924895 ACAGCCTGCCAGGACCTCTAGGG - Intergenic
1066651575 10:37661165-37661187 GCCTCCTGCCTGGGCCTCTCAGG - Intergenic
1067035355 10:42911595-42911617 GCCTCCTGCCTGGGCCCCTCAGG - Intergenic
1067048758 10:43000251-43000273 ACAGCCAGCCTGGGCCTCCCAGG + Intergenic
1070605975 10:77898757-77898779 ACCGCCTGCCTGGCCCTCTCAGG - Intronic
1070677314 10:78420988-78421010 ACTGCCTTCCTGGCTCTCCCAGG + Intergenic
1070801638 10:79247452-79247474 ACTGCCTGCTTGGCCCACCCAGG - Intronic
1070819126 10:79344680-79344702 ATCACCTGCCTGGCCCCCGCAGG + Intergenic
1072623620 10:97096962-97096984 ACAGCCTTCCTGCTCCTCTCTGG + Intronic
1076604610 10:131681327-131681349 AGTGTCTGCCTGGCCCTTTCGGG + Intergenic
1076759497 10:132594783-132594805 GCTGCCTGCCTGGAGCTCTCTGG + Intronic
1077009039 11:371992-372014 ACAGCCTGCCTGCCCTGCTCTGG + Intronic
1077146982 11:1050751-1050773 ACCTCCTGCCTGGCCCTCCCAGG - Intergenic
1077163132 11:1122628-1122650 AGCGCCTGCCTGGCCACCCCTGG + Intergenic
1077195951 11:1280251-1280273 AGCCCTTGGCTGGCCCTCTCTGG + Intronic
1077240770 11:1509270-1509292 AGGGCCTGCCTCTCCCTCTCAGG + Intergenic
1077319524 11:1935034-1935056 ACAGCCTGTTTGGGCCTCTCAGG - Intronic
1077531835 11:3100890-3100912 CCCTCCTGCCTGTCCCACTCCGG + Intronic
1077668160 11:4134212-4134234 TCCGCCTGCCTTGGCCTCCCAGG + Intronic
1078335182 11:10457650-10457672 TCCGCCTGCCTTGGCCTCCCAGG - Intronic
1079263303 11:18905058-18905080 CTGACCTGCCTGGCCCTCTCTGG + Intergenic
1079265559 11:18928789-18928811 CTGCCCTGCCTGGCCCTCTCTGG + Intergenic
1081578488 11:44334658-44334680 AGCTCCTGCCTGCCCCTCCCAGG - Intergenic
1083618942 11:64039526-64039548 ACCACAGCCCTGGCCCTCTCAGG - Intronic
1083618969 11:64039620-64039642 ACAGCCTGCCTGGAGTTCTCTGG + Intronic
1083779350 11:64910007-64910029 ACCCCCGGCCTGGCCCTGGCAGG + Intronic
1084563929 11:69919112-69919134 AAAGCCTGCCTGGCCCTCCCAGG + Intergenic
1084769292 11:71332183-71332205 AGCGTCTGCCTGGTCCTCCCAGG - Intergenic
1087057479 11:93947876-93947898 GCCGCCTGCCTTGGCCTCCCAGG - Intergenic
1089260341 11:117219841-117219863 TCCTCCTGCCTGGGCCTCCCAGG - Intronic
1091038363 11:132254221-132254243 ATCTCCTGCCTGCCCCTCCCTGG + Intronic
1091395530 12:152176-152198 ACCTCCTGCCTTCCCCTTTCTGG - Intronic
1091938311 12:4451022-4451044 ATCCCCTGCCTCTCCCTCTCTGG + Intergenic
1092793979 12:12092564-12092586 CTCCCCTGCCTGTCCCTCTCGGG - Intronic
1093465002 12:19439958-19439980 CCGGCCTGGCTGGCGCTCTCGGG - Exonic
1095961117 12:47834917-47834939 ATCCCCTCCCTGTCCCTCTCCGG + Intergenic
1095965453 12:47864210-47864232 GGGGCCAGCCTGGCCCTCTCTGG - Intronic
1096185776 12:49579593-49579615 AGAGCCTGCCTGGCACACTCAGG - Intronic
1097876558 12:64649049-64649071 TCCTCCTGCCTTGGCCTCTCAGG + Intronic
1097897606 12:64841397-64841419 ACCCCATGCCTGGCCCACTGTGG + Intronic
1098899174 12:76095181-76095203 TCCGCCTGCCTTGGCATCTCAGG - Intergenic
1101897923 12:108769816-108769838 ACCCCCTGCCTGGTCCACCCAGG + Intergenic
1102460549 12:113097136-113097158 ACTCTCTGCTTGGCCCTCTCAGG - Exonic
1104066305 12:125310059-125310081 AGCTCCTGCCTGGTCCTCTTGGG - Intronic
1104776884 12:131394837-131394859 ACCTCCTGCTTGGCCTCCTCTGG + Intergenic
1104831880 12:131758012-131758034 GCCTCCTGCCTGCCCCTCTGTGG - Intronic
1105783799 13:23727983-23728005 CCACCGTGCCTGGCCCTCTCTGG - Intergenic
1112494185 13:99892943-99892965 CCCGCATGTCTGTCCCTCTCTGG - Exonic
1113053101 13:106236562-106236584 CCACCATGCCTGGCCCTCTCTGG + Intergenic
1113521662 13:110946221-110946243 CATGCCAGCCTGGCCCTCTCTGG - Intergenic
1115053476 14:29093241-29093263 CCTGCCTGCCTGGCTCTCTTCGG + Intergenic
1117338526 14:54775040-54775062 TCCGCCCGCCTGGGCCTCTTGGG + Exonic
1118609525 14:67529222-67529244 ATCCGCTGCCTGGCTCTCTCTGG + Intronic
1118650178 14:67882985-67883007 TCCGCCTGCCTTGGCCTCCCAGG + Intronic
1119381859 14:74234253-74234275 ACCACCTGGCTGGCCACCTCGGG - Intergenic
1122639664 14:103151350-103151372 TTCGCCTGCCTGCCTCTCTCAGG - Intergenic
1122812536 14:104296178-104296200 CCCGCCTGCCTAGTCCTCCCTGG + Intergenic
1122969244 14:105145792-105145814 ACCCCCTGCCTGCCACGCTCCGG - Exonic
1123664480 15:22597661-22597683 TCTGCCTGCCTCGTCCTCTCAGG + Intergenic
1124318317 15:28692098-28692120 TCTGCCTGCCTCGTCCTCTCAGG + Intergenic
1127158080 15:56150166-56150188 ACTGCCTGATTGCCCCTCTCTGG + Intronic
1128940046 15:71780638-71780660 ACAGGCTGCCTTGCCCTCCCTGG - Exonic
1128976755 15:72159982-72160004 TCCCCCTGCCTGGTCCTCTGGGG - Exonic
1129848477 15:78778785-78778807 ACCCCCTGCCTGTCCCAATCAGG - Intronic
1130253445 15:82315162-82315184 ACCCCCTGCCTGTCCCAATCAGG + Intergenic
1130640689 15:85671753-85671775 AGTGCCTTCCTGGCCTTCTCTGG - Intronic
1131124621 15:89848600-89848622 TCCGCCTGCCTTGGCCTCCCAGG + Intronic
1131254434 15:90852738-90852760 AAAGCCTGCCTGGCCCTCGGAGG + Intergenic
1131829836 15:96347266-96347288 CCCACCTCCCTGGCCCTCTCTGG + Intergenic
1132671313 16:1103224-1103246 CCCGCCTGCCTGCCCCGCCCCGG - Intergenic
1132747465 16:1442996-1443018 TCAGCCCGCCTGGGCCTCTCGGG - Intronic
1132760871 16:1508090-1508112 CCCGCCTCCCTGGGCCCCTCCGG + Intronic
1132775323 16:1590488-1590510 GCCTCCTGCCAGGCTCTCTCTGG + Intronic
1133031287 16:3012462-3012484 CCCGCCCGCCTGGGACTCTCTGG - Exonic
1133809033 16:9147041-9147063 GCTGCCTGCCTGTCGCTCTCAGG + Intergenic
1134089738 16:11385073-11385095 ACCTCCTGCCCAGCCCCCTCTGG - Intronic
1134335017 16:13290663-13290685 ACCCCCTGCCTCCCTCTCTCTGG + Intergenic
1134453201 16:14376011-14376033 AACTCCTGCCTGCCTCTCTCTGG - Intergenic
1136625847 16:31461826-31461848 AAAGCCTTCCAGGCCCTCTCAGG + Intronic
1138490278 16:57372525-57372547 GCCGCCTGCCTGGCCCCCGCCGG + Exonic
1139163455 16:64538584-64538606 ACCCCCTTTCTGGCTCTCTCTGG + Intergenic
1139815226 16:69664525-69664547 TCCGCCTGCCTCGGCCTCTCAGG + Intronic
1140407224 16:74718924-74718946 GCTGGCTGCCGGGCCCTCTCGGG + Intronic
1140504181 16:75460065-75460087 ACTGCCTGCCTGCTCCTCCCTGG + Intronic
1140511576 16:75512571-75512593 ACTGCCTGCCTGCTCCTCCCTGG + Intergenic
1141423466 16:83931485-83931507 TCCTCCTGCCTGGCCCTACCAGG - Intronic
1141577467 16:84973411-84973433 GCCGCCTGCATGGGCCTGTCGGG + Intergenic
1141698163 16:85630188-85630210 ACCTCCTTCCTGGCCCTCTTGGG - Intronic
1141882128 16:86867165-86867187 ACCTCCGGCCTGGACCTCCCTGG + Intergenic
1142215289 16:88826780-88826802 ACCACCAGCCTGGCCCTTGCGGG - Exonic
1142356010 16:89602432-89602454 ACCGGCTGCCTGGGCCTCACAGG + Intergenic
1143121979 17:4613885-4613907 TCCGCCTGCCTTGGCCTCCCAGG + Intergenic
1145005583 17:19335983-19336005 ACCACCTGCCAGCCCCTCTCTGG + Exonic
1145216948 17:21060010-21060032 ACTGCCTGCCTGGCCATAACCGG - Intergenic
1145937021 17:28720256-28720278 ACCGAATGTCTGGCCCTCCCTGG - Intronic
1147311415 17:39598179-39598201 ACTGCATGCCTGGTCCTCACCGG + Intergenic
1147647290 17:42041238-42041260 ACTGCCTGCCTCCGCCTCTCAGG - Intronic
1147662296 17:42123196-42123218 ACCTGCTGCCTGACCCCCTCCGG + Exonic
1147970358 17:44216171-44216193 ACTGACTGCCTGGGCCTCTGCGG - Intronic
1148688561 17:49513894-49513916 TCCCTCTGCCTGTCCCTCTCAGG + Exonic
1150233750 17:63575455-63575477 TCTGCCTGTCTCGCCCTCTCAGG - Intronic
1152600443 17:81259556-81259578 ACTGCCTCCCTGACCCTCCCAGG - Intronic
1152612833 17:81323970-81323992 ACTCCCTGGCTGACCCTCTCGGG - Intronic
1152638300 17:81439156-81439178 ACCTCCAGCCAGGCCCTCTCCGG - Intronic
1152655039 17:81515297-81515319 CCCAGCTGCCCGGCCCTCTCCGG - Intronic
1152699296 17:81811183-81811205 GGCCCCTGCCTGGCCCTCACAGG + Intronic
1152798137 17:82317863-82317885 CCAGCCTGCCTGGTCCTCTGGGG + Intergenic
1155344400 18:24844113-24844135 CCACCCTGCCCGGCCCTCTCTGG + Intergenic
1156481483 18:37439225-37439247 ACCCACCGCCTGCCCCTCTCAGG - Intronic
1157425436 18:47580552-47580574 GCCCCCTTCCTGGCCCTCTCAGG - Intergenic
1157779740 18:50427730-50427752 ACCTCCTCCCTGGCCCCCTGGGG - Intergenic
1160014518 18:75129819-75129841 ACAGCCTCCCAGGCCCTCTCGGG - Intergenic
1160030107 18:75250232-75250254 ACCTCCTGGCTGGCCCTGCCAGG + Intronic
1160887016 19:1354868-1354890 AGCGCCGGCCTCGCCCTCTCCGG - Intronic
1160963475 19:1735088-1735110 GCCACCTGCCTGCCCCTCCCCGG - Intergenic
1161566301 19:5004713-5004735 ACCGCCTTCCTGCCCCTCTGTGG - Intronic
1161574211 19:5046966-5046988 ACCGCCAGCTTGGCCCTTCCAGG - Intronic
1162908488 19:13836997-13837019 CCCGCCTGCCTGGCCCCCCTTGG - Intergenic
1163537662 19:17886548-17886570 TCCGCCTGCCTTGGCCTCCCAGG + Intronic
1163757041 19:19112378-19112400 ACAGGCTGCCTGGGCCTCTGGGG - Exonic
1165319842 19:35078377-35078399 ACCGCCTGCCTTGGCTTCCCAGG + Intergenic
1166042791 19:40213596-40213618 ACTGCCTGCCGAGCCCTCCCCGG + Exonic
1167093100 19:47358134-47358156 ACCCCCCGCCTGCCCCACTCGGG - Intronic
925192691 2:1898526-1898548 ACTGCCTGCCTGGCCTGCCCTGG + Intronic
926012594 2:9420695-9420717 GCGGCCTGCCTGGCCTTCTGTGG - Intronic
927239823 2:20911475-20911497 ACCCACTGCCTGGCACTCCCCGG + Intergenic
928534337 2:32225657-32225679 CCCACCTACCTGGCCCTTTCTGG + Intronic
929431633 2:41892574-41892596 TCAGCCTGCCTGTGCCTCTCAGG - Intergenic
932075521 2:68659315-68659337 AACCCCTGTCTGGCCCTCTCTGG + Intergenic
934264450 2:91502446-91502468 TCCTCCTGCCTGGGCCTCCCGGG + Intergenic
934556173 2:95288226-95288248 GCCACCTGCCAGCCCCTCTCCGG + Exonic
936034730 2:109101764-109101786 ACCCCCTGCTCGGCTCTCTCCGG - Intergenic
936545955 2:113393549-113393571 ATCCTCTGCCTGACCCTCTCTGG - Intergenic
937670956 2:124536695-124536717 GCCCCCTCCCTGGCCCGCTCTGG - Intronic
937973258 2:127565950-127565972 ACTGCCTGCCTGGGCCTCTCTGG + Intronic
938067277 2:128287926-128287948 CCTGCCTGCCTGGCACTTTCTGG + Intronic
938288993 2:130139752-130139774 GCGGCCTGCATGGCCCTCACGGG + Intronic
938467537 2:131533186-131533208 GCGGCCTGCATGGCCCTCACGGG - Intronic
941908300 2:170738025-170738047 ACGGCCTGGCTGTGCCTCTCAGG - Intergenic
944283663 2:197923787-197923809 GCCGCCTGCCTTGGCCTCCCAGG - Intronic
945239880 2:207666756-207666778 ACCACCTGCCTGGCCCTTATGGG + Intergenic
945882559 2:215341626-215341648 TCCACCTGTCTGGCTCTCTCAGG - Intronic
948526540 2:238574250-238574272 ACCGCCTACCTGGCCCATGCGGG - Intergenic
948560226 2:238847278-238847300 CCCGCCTGCCTGGCCCTACCCGG - Intergenic
949047047 2:241877028-241877050 ATCGCCTGCCAGGCCACCTCTGG + Intergenic
1169075707 20:2758837-2758859 GCCACCTGCCTGTCACTCTCTGG - Intronic
1170858111 20:20076264-20076286 AGCTTCTGCCTGGCTCTCTCAGG + Intronic
1171159430 20:22908090-22908112 ACCTCCTGCTGGGCACTCTCAGG - Intergenic
1172284686 20:33732253-33732275 CCCGCCGGCCTGGCTCTCCCCGG - Intronic
1172308963 20:33902279-33902301 AGCTCCTGCCTGACCCTCCCAGG + Intergenic
1172371243 20:34393942-34393964 CCACCATGCCTGGCCCTCTCAGG - Intronic
1172442014 20:34972374-34972396 ACCGGCTTCTTGGCACTCTCTGG + Intergenic
1172807426 20:37622521-37622543 CCCCCTTGCCTGGCACTCTCTGG - Intergenic
1173403138 20:42742353-42742375 ACCACCTGCCCCGCCCTCACGGG + Intronic
1173557096 20:43973965-43973987 AACCCCAGCCTGGCCCTCTGGGG + Intronic
1174175014 20:48639093-48639115 ATCACCTGCCTGGCCCTTGCCGG - Intronic
1175105033 20:56609184-56609206 GCCGCCTGCCTGGCCCTAAAGGG + Intergenic
1175737034 20:61394304-61394326 CGCCCCTGCCTGTCCCTCTCGGG + Intronic
1175826985 20:61941808-61941830 GCCTCCTGCCTGGCCATCCCAGG - Intergenic
1177439224 21:21098914-21098936 ATCGCGTGCCTGGCCATTTCAGG - Intronic
1178522327 21:33296703-33296725 TCCGCCTGCCTCGACCTCTAAGG - Exonic
1179628993 21:42665366-42665388 ACCCCCATCCTGGCCCTCTGAGG + Intronic
1180787262 22:18553941-18553963 GCCCACTGCCTGGCCCTGTCGGG + Intergenic
1181244170 22:21493466-21493488 GCCCACTGCCTGGCCCTGTCGGG + Intergenic
1181388945 22:22565177-22565199 ACGGCCTTCCTGGCCGTCTTTGG + Exonic
1181390944 22:22580229-22580251 ACGGCCTCCCTGACCATCTCTGG + Intergenic
1181412662 22:22735006-22735028 ACGGCCTCCCTGACCATCTCTGG + Intronic
1181415998 22:22759128-22759150 ACGGCCTCCCTGACCATCTCTGG + Intronic
1181420288 22:22792920-22792942 ACGGCCTCCCTGACCATCTCTGG + Intronic
1181424338 22:22823206-22823228 ACGGCCTCCCTGACCGTCTCTGG + Intronic
1181625744 22:24121065-24121087 CCAGCATACCTGGCCCTCTCTGG - Intronic
1181770245 22:25119905-25119927 TCCCCCTCCCTGGCCCTATCCGG - Intronic
1182173727 22:28261037-28261059 TCCCACTGCCTGGCCCACTCAGG + Intronic
1182328899 22:29536328-29536350 ACCCCCTGCATGGCCCCCACCGG - Intronic
1182424366 22:30264362-30264384 CCCGCCTGCCCAGCCCCCTCAGG + Exonic
1183586793 22:38757482-38757504 ACAGCCTGCTTCCCCCTCTCCGG + Intronic
1183606974 22:38871794-38871816 GCCGCGTGCCTGTCCCTCTCTGG - Intronic
1184467592 22:44677928-44677950 AAAGCCTGCCAGGGCCTCTCTGG - Intronic
1184674806 22:46035947-46035969 ACCGCCCGCCTCACCCTCGCTGG + Intergenic
1184806323 22:46796893-46796915 GCCACCTGCCTGGCCCTCCTGGG - Intronic
1184882254 22:47315926-47315948 ACCTGCAGCCTGGCCCTTTCAGG + Intergenic
1185141138 22:49101972-49101994 AGCATCTGCCTGGCCCCCTCAGG - Intergenic
1185379851 22:50503346-50503368 CCCGGCGACCTGGCCCTCTCAGG + Exonic
952407263 3:33015662-33015684 GCCTCCTGCCTGGCTCTCACAGG - Intronic
953337032 3:42102226-42102248 TCCGCCTGCCTTGGCCTCCCAGG + Intronic
953736441 3:45498003-45498025 ACCACCAGCATGGCCTTCTCTGG + Intronic
954038122 3:47864196-47864218 TCCTCCTGCCTGGGCCTCCCAGG + Intronic
954626325 3:52023891-52023913 ACCGGCTGCCTGACTCTCTAGGG + Intergenic
966967021 3:185004109-185004131 GCCGCCTGCCTTGGCCTCCCGGG - Intronic
967118434 3:186362072-186362094 CCCGCCTGCGCAGCCCTCTCGGG + Exonic
967146786 3:186613112-186613134 CACGCCTGCCAGGGCCTCTCTGG + Exonic
967865315 3:194185440-194185462 ACCGCCTGCAGTGCCATCTCTGG - Intergenic
968285292 3:197505080-197505102 ACCGCCTGCTTGGCAGCCTCAGG + Intergenic
968458341 4:710331-710353 ACGTCCTTCCTGTCCCTCTCTGG - Intronic
968572002 4:1346903-1346925 GCAGCCTGCCTCGCCCTCGCCGG + Intergenic
968596290 4:1487577-1487599 AAGGCCTGCCTGACCCCCTCAGG - Intergenic
968672334 4:1858230-1858252 ACCTCCTGCCTGGCCTTGCCGGG - Intergenic
968685052 4:1952343-1952365 CCCCACCGCCTGGCCCTCTCTGG + Intronic
969103067 4:4784540-4784562 TCCTCTTCCCTGGCCCTCTCGGG + Intergenic
975561346 4:75710949-75710971 ACACCGTGCCTGGCCCTGTCTGG + Intronic
978579105 4:110214923-110214945 ACCCCCAGCCTGACCATCTCTGG + Intergenic
978709099 4:111755738-111755760 TCCGCCTGCCTCGGCCTCCCAGG - Intergenic
979206678 4:118046503-118046525 CCAGCCTGCCAGCCCCTCTCAGG + Intronic
982101773 4:151975376-151975398 CCACCGTGCCTGGCCCTCTCAGG + Intergenic
984247641 4:177294939-177294961 TCCGCCTGCCTTGGCCTCCCAGG - Intergenic
984785774 4:183566091-183566113 CCTGCCTGCCTGGACTTCTCTGG - Intergenic
985485193 5:144891-144913 GCCGTCTCCCAGGCCCTCTCAGG + Exonic
985546254 5:510672-510694 GCCGCCTGCCTGGGCCTTTCCGG - Intronic
986015073 5:3750719-3750741 ACCTCCTCCCTGTCCCTCCCAGG + Intergenic
989473934 5:41852813-41852835 GCCGCCTGCCTTGGCCTCACAGG - Intronic
992391784 5:76336522-76336544 GCCGCCTGCCTTGGCCTCCCGGG - Intronic
997852073 5:137342000-137342022 ACCGCAGCCCTGGCGCTCTCTGG - Intronic
997996478 5:138590782-138590804 ACCTCATGCCAGCCCCTCTCTGG + Intergenic
998030059 5:138858839-138858861 TCCGCCTGCCTCGGCCTCCCAGG + Intronic
998092579 5:139379936-139379958 GCCGCCTGCCAGGTCCTCACAGG + Exonic
999291663 5:150429910-150429932 ACCTCCTGCCTGGCCCTCTGAGG - Intergenic
1000390473 5:160717994-160718016 TCAGCCTGGCTGGCCCTCTGTGG - Intronic
1002043820 5:176531320-176531342 AGCGCCTGCCTGGCCTCCCCAGG - Intronic
1002306842 5:178288529-178288551 CCCTCCAGCCTGGCCCTCTGAGG - Intronic
1004700970 6:18079108-18079130 CCAGCCTCCCTGGCCCTCTGTGG - Intergenic
1006058789 6:31404412-31404434 ACCTCCTCCCTGCCCATCTCAGG + Intronic
1006391758 6:33762852-33762874 ACCATCTGCTTGTCCCTCTCTGG + Intergenic
1007239252 6:40413397-40413419 ACTGCCTCCCTGGCCCACCCAGG - Intronic
1007375995 6:41457057-41457079 TCAGCCTGCCTGACCCTCTGGGG - Intergenic
1007590146 6:43016173-43016195 TCCACCTGCCTCGGCCTCTCAGG + Intronic
1007778152 6:44235383-44235405 ACCTCCTGCCTGGCCCACTGGGG + Intergenic
1012571546 6:100736260-100736282 TCTGCCTGCCTCGGCCTCTCAGG - Intronic
1015571588 6:134626655-134626677 ACCACGTGCCTGGCTCTCTCTGG + Intergenic
1016371752 6:143381956-143381978 AAGGCCTTCCTGACCCTCTCTGG - Intergenic
1016778459 6:147932287-147932309 ACCCCCTGGCTTTCCCTCTCAGG - Intergenic
1017298427 6:152827318-152827340 TCCTCCTGCCTTGGCCTCTCAGG + Intergenic
1018063453 6:160108561-160108583 ACTGCCTGCGAGGCTCTCTCTGG + Intronic
1019189822 6:170245449-170245471 TCCTCCTGCCAGGCCCTCGCAGG + Intergenic
1019286629 7:226511-226533 GCCGCCCGGCTGGGCCTCTCAGG + Intronic
1019348837 7:543631-543653 ACCCCAAGCCTGGACCTCTCAGG - Intergenic
1019366106 7:633876-633898 ACCACCTGCCTGGGCTCCTCAGG + Intronic
1020088707 7:5325176-5325198 AGCTCCTGCCTTGCCCTCTGAGG - Exonic
1020089827 7:5332875-5332897 ACCGCCAGCTTGGCCTTGTCTGG + Exonic
1021084699 7:16408479-16408501 ACCTCCTGCCTGGGCCTCCAAGG - Intronic
1022218817 7:28291782-28291804 ACCAGCTGCCTGGCCCCCACTGG - Intergenic
1023873641 7:44275756-44275778 ACCGCATGCCTGCCCCTCCCAGG - Intronic
1026938497 7:74272850-74272872 AAAGCCTGCCTGGCCCTGGCTGG + Intergenic
1027482207 7:78712295-78712317 AATGCCTGCCTGGCACTCTGAGG + Intronic
1031121562 7:117728167-117728189 AACTCCTGCCTGGCCCGCTTGGG - Exonic
1031999138 7:128253570-128253592 ACCCCCTGCATGGAGCTCTCTGG + Intronic
1032525771 7:132577342-132577364 TCCAGCTGCCTGGCGCTCTCTGG + Intronic
1034154162 7:148940943-148940965 CCGGCCGGCCTGTCCCTCTCCGG - Intergenic
1034404419 7:150892543-150892565 TCCCACTGCCTGGCCATCTCAGG - Intergenic
1034490556 7:151391070-151391092 AGGGCCTGATTGGCCCTCTCGGG - Intronic
1034561554 7:151883034-151883056 ACTGCCTGACTGCCCCTTTCTGG + Intergenic
1035828402 8:2668787-2668809 ACACCCAGCCAGGCCCTCTCAGG + Intergenic
1036485048 8:9171887-9171909 TCCGCCTGCCCAGCCATCTCTGG - Intergenic
1038457900 8:27689786-27689808 ACCGCCTTTCTGGCCCACACTGG - Intergenic
1039748903 8:40458523-40458545 TCCGCCTGCCTCGGCCTCCCAGG - Intergenic
1041304607 8:56446622-56446644 AGCGCCTGCCTCGCCGTCCCGGG + Intronic
1042802490 8:72734866-72734888 ACCACCTGCCTGGCCCTGGTGGG - Intronic
1043383613 8:79728098-79728120 ACCCCCTGCCTGGGCCACTATGG + Intergenic
1043866146 8:85378068-85378090 ACCCCCTGCGTGGTCCTCTGTGG - Exonic
1045001584 8:97883059-97883081 TCTGCCTGCCTTGGCCTCTCAGG - Intronic
1047407131 8:124595091-124595113 ACCACCAGGCTGGCCCTATCTGG + Intronic
1048853089 8:138662906-138662928 TCCTCCTGCCTCGCCCTCCCCGG - Intronic
1049353316 8:142175687-142175709 ACCCACTGCCTGGCACTCACCGG + Intergenic
1049363314 8:142224636-142224658 ACCTCCTGCCTGGCCCTCACAGG - Intronic
1049504230 8:142986250-142986272 ACACCCTGCCTAGCCCTCTTGGG - Intergenic
1053239887 9:36487275-36487297 CCTCCCTGCCTGGCCCGCTCCGG + Intronic
1053476441 9:38385304-38385326 CCCCCTTGCCTGGGCCTCTCTGG - Intergenic
1056211965 9:84373233-84373255 ACAGCCTTCTTGGTCCTCTCTGG + Intergenic
1056644452 9:88398814-88398836 TCCGCCTGCCTTGGCCTCCCTGG + Intronic
1056714041 9:89013904-89013926 GCTCCCTCCCTGGCCCTCTCAGG + Intronic
1059053429 9:110953157-110953179 CCCACATGCCTGGCCCACTCAGG + Intronic
1061773443 9:132944927-132944949 ACCGCCCGCCCCGCCCCCTCGGG - Intergenic
1061919597 9:133775570-133775592 AGAGCTTGCCTTGCCCTCTCAGG - Intronic
1061948325 9:133921088-133921110 ATAGCCTGCCTTCCCCTCTCAGG - Intronic
1062069684 9:134548850-134548872 ACCTCCTCCCAGGCCCGCTCAGG + Intergenic
1062170062 9:135129747-135129769 ACAGCCTGCCTGGCCCTCTGAGG - Intergenic
1189298494 X:39935784-39935806 ACCTCCAGCCAGGCCCTCCCAGG + Intergenic
1189429903 X:40937086-40937108 TCCACCTGCCTGGGCCTCCCAGG - Intergenic
1190344236 X:49322467-49322489 ACCGCCCGCCTCGCCCCCGCCGG - Intronic
1190345331 X:49332012-49332034 ACCGCCCGCCTCGCCCCCGCCGG - Intronic
1190346426 X:49341577-49341599 ACCGCCCGCCTCGCCCCCGCCGG - Intronic
1190347677 X:49532606-49532628 ACCGCCCGCCTCGCCCCCGCCGG - Intronic
1190348778 X:49542162-49542184 ACCGCCCGCCTCGCCCCCGCCGG - Intronic
1190349878 X:49551718-49551740 ACCGCCCGCCTCGCCCCCGCCGG - Intronic
1190350983 X:49561271-49561293 ACCGCCCGCCTCGCCCCCGCCGG - Intronic
1190352084 X:49570829-49570851 ACCGCCCGCCTCGCCCCCGCCGG - Intronic
1190353185 X:49580378-49580400 ACCGCCCGCCTCGCCCCCGCCGG - Intronic
1190354285 X:49589925-49589947 ACCGCCTGCCTCGCCCCCGCCGG - Intronic
1190355388 X:49599449-49599471 ACCGCCCGCCTCGCCCCCGCCGG - Intronic
1190650265 X:52562818-52562840 ATCTCCCACCTGGCCCTCTCTGG + Intergenic
1190896383 X:54622525-54622547 TCCGCCTGCCTCGGCCTCCCAGG + Intergenic
1195461838 X:105135994-105136016 ACTGCCTGCTTGGCCATCTGTGG - Intronic
1199950962 X:152706077-152706099 ACAGCCTGCCTGGGGCTCTGTGG - Intergenic
1199958720 X:152762384-152762406 ACAGCCTGCCTGGGGCTCTGTGG + Intergenic