ID: 1070605978

View in Genome Browser
Species Human (GRCh38)
Location 10:77898770-77898792
Sequence GGCAGGCGGTAAGGAAGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070605968_1070605978 9 Left 1070605968 10:77898738-77898760 CCTGACAGGCCTGTGCATGCCTG 0: 1
1: 0
2: 3
3: 53
4: 927
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605962_1070605978 27 Left 1070605962 10:77898720-77898742 CCCCTCCATGGCCTGGCTCCTGA 0: 1
1: 0
2: 8
3: 48
4: 388
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605971_1070605978 0 Left 1070605971 10:77898747-77898769 CCTGTGCATGCCTGAGAGGGCCA 0: 1
1: 0
2: 2
3: 21
4: 292
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605963_1070605978 26 Left 1070605963 10:77898721-77898743 CCCTCCATGGCCTGGCTCCTGAC 0: 1
1: 1
2: 7
3: 51
4: 440
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605961_1070605978 28 Left 1070605961 10:77898719-77898741 CCCCCTCCATGGCCTGGCTCCTG 0: 1
1: 2
2: 11
3: 86
4: 699
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605964_1070605978 25 Left 1070605964 10:77898722-77898744 CCTCCATGGCCTGGCTCCTGACA 0: 1
1: 0
2: 3
3: 44
4: 368
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605967_1070605978 16 Left 1070605967 10:77898731-77898753 CCTGGCTCCTGACAGGCCTGTGC No data
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605966_1070605978 22 Left 1070605966 10:77898725-77898747 CCATGGCCTGGCTCCTGACAGGC 0: 1
1: 0
2: 3
3: 44
4: 349
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data
1070605975_1070605978 -10 Left 1070605975 10:77898757-77898779 CCTGAGAGGGCCAGGCAGGCGGT 0: 1
1: 0
2: 5
3: 22
4: 292
Right 1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070605978 Original CRISPR GGCAGGCGGTAAGGAAGTAG AGG Intronic
No off target data available for this crispr