ID: 1070610050

View in Genome Browser
Species Human (GRCh38)
Location 10:77926734-77926756
Sequence GGCTGCCGCGGCGGCGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070610044_1070610050 -5 Left 1070610044 10:77926716-77926738 CCGGAGCGCAGCCATGTTGGCTG 0: 1
1: 0
2: 2
3: 10
4: 141
Right 1070610050 10:77926734-77926756 GGCTGCCGCGGCGGCGGGACTGG No data
1070610042_1070610050 2 Left 1070610042 10:77926709-77926731 CCGGGCTCCGGAGCGCAGCCATG 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1070610050 10:77926734-77926756 GGCTGCCGCGGCGGCGGGACTGG No data
1070610040_1070610050 6 Left 1070610040 10:77926705-77926727 CCTCCCGGGCTCCGGAGCGCAGC 0: 1
1: 0
2: 1
3: 12
4: 209
Right 1070610050 10:77926734-77926756 GGCTGCCGCGGCGGCGGGACTGG No data
1070610039_1070610050 9 Left 1070610039 10:77926702-77926724 CCGCCTCCCGGGCTCCGGAGCGC 0: 1
1: 0
2: 2
3: 32
4: 339
Right 1070610050 10:77926734-77926756 GGCTGCCGCGGCGGCGGGACTGG No data
1070610041_1070610050 3 Left 1070610041 10:77926708-77926730 CCCGGGCTCCGGAGCGCAGCCAT 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1070610050 10:77926734-77926756 GGCTGCCGCGGCGGCGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070610050 Original CRISPR GGCTGCCGCGGCGGCGGGAC TGG Intergenic
No off target data available for this crispr