ID: 1070612021

View in Genome Browser
Species Human (GRCh38)
Location 10:77939899-77939921
Sequence CTGAACATACAAATGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070612011_1070612021 26 Left 1070612011 10:77939850-77939872 CCACCGCAGAGATAGCTGCTTGG No data
Right 1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG No data
1070612017_1070612021 -5 Left 1070612017 10:77939881-77939903 CCATGAAGACCTCTGAGACTGAA No data
Right 1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG No data
1070612014_1070612021 23 Left 1070612014 10:77939853-77939875 CCGCAGAGATAGCTGCTTGGGTG No data
Right 1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070612021 Original CRISPR CTGAACATACAAATGGGCAA TGG Intergenic
No off target data available for this crispr