ID: 1070612506

View in Genome Browser
Species Human (GRCh38)
Location 10:77943255-77943277
Sequence CTCTAACAGAGGTGGAAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070612506_1070612510 -9 Left 1070612506 10:77943255-77943277 CCGTGCTTCCACCTCTGTTAGAG No data
Right 1070612510 10:77943269-77943291 CTGTTAGAGCCCAGGCCCTGAGG No data
1070612506_1070612512 -2 Left 1070612506 10:77943255-77943277 CCGTGCTTCCACCTCTGTTAGAG No data
Right 1070612512 10:77943276-77943298 AGCCCAGGCCCTGAGGGCATAGG No data
1070612506_1070612511 -8 Left 1070612506 10:77943255-77943277 CCGTGCTTCCACCTCTGTTAGAG No data
Right 1070612511 10:77943270-77943292 TGTTAGAGCCCAGGCCCTGAGGG No data
1070612506_1070612513 -1 Left 1070612506 10:77943255-77943277 CCGTGCTTCCACCTCTGTTAGAG No data
Right 1070612513 10:77943277-77943299 GCCCAGGCCCTGAGGGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070612506 Original CRISPR CTCTAACAGAGGTGGAAGCA CGG (reversed) Intergenic
No off target data available for this crispr