ID: 1070615233

View in Genome Browser
Species Human (GRCh38)
Location 10:77964555-77964577
Sequence AAACCCTGCTTCACAAGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070615233_1070615239 16 Left 1070615233 10:77964555-77964577 CCTATCCTTGTGAAGCAGGGTTT No data
Right 1070615239 10:77964594-77964616 ATGAGATTATGGAGTAGACTGGG No data
1070615233_1070615236 5 Left 1070615233 10:77964555-77964577 CCTATCCTTGTGAAGCAGGGTTT No data
Right 1070615236 10:77964583-77964605 AGTGAACCAAAATGAGATTATGG No data
1070615233_1070615238 15 Left 1070615233 10:77964555-77964577 CCTATCCTTGTGAAGCAGGGTTT No data
Right 1070615238 10:77964593-77964615 AATGAGATTATGGAGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070615233 Original CRISPR AAACCCTGCTTCACAAGGAT AGG (reversed) Intergenic
No off target data available for this crispr