ID: 1070615236

View in Genome Browser
Species Human (GRCh38)
Location 10:77964583-77964605
Sequence AGTGAACCAAAATGAGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070615228_1070615236 25 Left 1070615228 10:77964535-77964557 CCTGCTTCCGTTTCCAACATCCT No data
Right 1070615236 10:77964583-77964605 AGTGAACCAAAATGAGATTATGG No data
1070615234_1070615236 0 Left 1070615234 10:77964560-77964582 CCTTGTGAAGCAGGGTTTTCCTC No data
Right 1070615236 10:77964583-77964605 AGTGAACCAAAATGAGATTATGG No data
1070615233_1070615236 5 Left 1070615233 10:77964555-77964577 CCTATCCTTGTGAAGCAGGGTTT No data
Right 1070615236 10:77964583-77964605 AGTGAACCAAAATGAGATTATGG No data
1070615230_1070615236 12 Left 1070615230 10:77964548-77964570 CCAACATCCTATCCTTGTGAAGC No data
Right 1070615236 10:77964583-77964605 AGTGAACCAAAATGAGATTATGG No data
1070615229_1070615236 18 Left 1070615229 10:77964542-77964564 CCGTTTCCAACATCCTATCCTTG No data
Right 1070615236 10:77964583-77964605 AGTGAACCAAAATGAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070615236 Original CRISPR AGTGAACCAAAATGAGATTA TGG Intergenic