ID: 1070615238

View in Genome Browser
Species Human (GRCh38)
Location 10:77964593-77964615
Sequence AATGAGATTATGGAGTAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070615234_1070615238 10 Left 1070615234 10:77964560-77964582 CCTTGTGAAGCAGGGTTTTCCTC No data
Right 1070615238 10:77964593-77964615 AATGAGATTATGGAGTAGACTGG No data
1070615233_1070615238 15 Left 1070615233 10:77964555-77964577 CCTATCCTTGTGAAGCAGGGTTT No data
Right 1070615238 10:77964593-77964615 AATGAGATTATGGAGTAGACTGG No data
1070615229_1070615238 28 Left 1070615229 10:77964542-77964564 CCGTTTCCAACATCCTATCCTTG No data
Right 1070615238 10:77964593-77964615 AATGAGATTATGGAGTAGACTGG No data
1070615235_1070615238 -9 Left 1070615235 10:77964579-77964601 CCTCAGTGAACCAAAATGAGATT No data
Right 1070615238 10:77964593-77964615 AATGAGATTATGGAGTAGACTGG No data
1070615230_1070615238 22 Left 1070615230 10:77964548-77964570 CCAACATCCTATCCTTGTGAAGC No data
Right 1070615238 10:77964593-77964615 AATGAGATTATGGAGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070615238 Original CRISPR AATGAGATTATGGAGTAGAC TGG Intergenic