ID: 1070617496

View in Genome Browser
Species Human (GRCh38)
Location 10:77980063-77980085
Sequence TTCCCTTGGAAGCCTAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070617494_1070617496 -6 Left 1070617494 10:77980046-77980068 CCACTCAGTTTTTTTCATTCCCT 0: 1
1: 0
2: 1
3: 65
4: 639
Right 1070617496 10:77980063-77980085 TTCCCTTGGAAGCCTAGCCATGG 0: 1
1: 0
2: 0
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070617496 Original CRISPR TTCCCTTGGAAGCCTAGCCA TGG Intronic
902459966 1:16567008-16567030 TCCACTTGGAAGCCCAGGCAAGG - Intronic
903659406 1:24967531-24967553 TTCCCTTGGCAGCTTCCCCAGGG - Intergenic
903781588 1:25823443-25823465 TTCCCTTGGGTGGCTGGCCAGGG + Intronic
906370209 1:45247504-45247526 CTCCCTTTGATGCCTAGCCGAGG + Intronic
910889352 1:92001110-92001132 TTCCCTTGGAAGCCCTGCACTGG + Intronic
913253974 1:116937758-116937780 TTCCTCTGTAAACCTAGCCAAGG + Intronic
913480613 1:119285694-119285716 TCCCCTTAAAACCCTAGCCAAGG + Intergenic
913605443 1:120461575-120461597 TCCACTTGGAAGCCCAGACAAGG + Intergenic
913642309 1:120824295-120824317 TCCACTTGGAAGCCCAGACAAGG + Intronic
913642488 1:120825835-120825857 TCCACTTGGAAGCCCAGACAAGG + Intronic
913642668 1:120827375-120827397 TCCACTTGGAAGCCCAGACAAGG + Intronic
913642784 1:120828422-120828444 TCCACTTGGAAGCCCAGACAAGG + Intronic
913643399 1:120833924-120833946 TCCACTTGGAAGCCCAGACAAGG + Intronic
914083097 1:144427647-144427669 TCCACTTGGAAGCCCAGACAAGG - Intronic
914178021 1:145296167-145296189 TCCACTTGGAAGCCCAGACAAGG - Intronic
914178566 1:145300929-145300951 TCCACTTGGAAGCCCAGACAAGG - Intronic
914179863 1:145312037-145312059 TCCACTTGGAAGCCCAGACAAGG - Intronic
914180409 1:145316807-145316829 TCCACTTGGAAGCCCAGACAAGG - Intronic
914180952 1:145321569-145321591 TCCACTTGGAAGCCCAGACAAGG - Intronic
914181495 1:145326319-145326341 TCCACTTGGAAGCCCAGACAAGG - Intronic
914182040 1:145331086-145331108 TCCACTTGGAAGCCCAGACAAGG - Intronic
914182585 1:145335842-145335864 TCCACTTGGAAGCCCAGACAAGG - Intronic
914183130 1:145340596-145340618 TCCACTTGGAAGCCCAGACAAGG - Intronic
914183675 1:145345350-145345372 TCCACTTGGAAGCCCAGACAAGG - Intronic
914184218 1:145350120-145350142 TCCACTTGGAAGCCCAGACAAGG - Intronic
914184762 1:145354884-145354906 TCCACTTGGAAGCCCAGACAAGG - Intronic
914185307 1:145359631-145359653 TCCACTTGGAAGCCCAGACAAGG - Intronic
914185852 1:145364385-145364407 TCCACTTGGAAGCCCAGACAAGG - Intronic
914186399 1:145369145-145369167 TCCACTTGGAAGCCCAGACAAGG - Intronic
914186943 1:145373893-145373915 TCCACTTGGAAGCCCAGACAAGG - Intronic
914187486 1:145378643-145378665 TCCACTTGGAAGCCCAGACAAGG - Intronic
914188031 1:145383399-145383421 TCCACTTGGAAGCCCAGACAAGG - Intronic
914188574 1:145388147-145388169 TCCACTTGGAAGCCCAGACAAGG - Intronic
914189116 1:145392903-145392925 TCCACTTGGAAGCCCAGACAAGG - Intronic
914210970 1:145578612-145578634 TCCACTTGGAAGCCCAGACAAGG - Intergenic
914269730 1:146069372-146069394 TCCACTTGGAAGCCCAGACAAGG - Intronic
914270271 1:146074100-146074122 TCCACTTGGAAGCCCAGACAAGG - Intronic
914270808 1:146078836-146078858 TCCACTTGGAAGCCCAGACAAGG - Intronic
914271345 1:146083566-146083588 TCCACTTGGAAGCCCAGACAAGG - Intronic
914271880 1:146088293-146088315 TCCACTTGGAAGCCCAGACAAGG - Intronic
914272417 1:146093011-146093033 TCCACTTGGAAGCCCAGACAAGG - Intronic
914272955 1:146097733-146097755 TCCACTTGGAAGCCCAGACAAGG - Intronic
914273493 1:146102455-146102477 TCCACTTGGAAGCCCAGACAAGG - Intronic
914274032 1:146107173-146107195 TCCACTTGGAAGCCCAGACAAGG - Intronic
914274569 1:146111883-146111905 TCCACTTGGAAGCCCAGACAAGG - Intronic
914275102 1:146116601-146116623 TCCACTTGGAAGCCCAGACAAGG - Intronic
914275456 1:146119783-146119805 CTCAGTTGGAAGCCTAGACATGG - Intronic
914275639 1:146121327-146121349 TCCACTTGGAAGCCCAGACAAGG - Intronic
914276170 1:146126065-146126087 TCCACTTGGAAGCCCAGACAAGG - Intronic
914366651 1:146985134-146985156 TCCACTTGGAAGCCCAGACAAGG + Intronic
914367187 1:146989895-146989917 TCCACTTGGAAGCCCAGACAAGG + Intronic
914485795 1:148108311-148108333 TCCACTTGGAAGCCCAGACAAGG - Intronic
914532567 1:148536053-148536075 TCCACTTGGAAGCCCAGACAAGG - Intronic
914533103 1:148540779-148540801 TCCACTTGGAAGCCCAGACAAGG - Intronic
914533638 1:148545493-148545515 TCCACTTGGAAGCCCAGACAAGG - Intronic
914534174 1:148550201-148550223 TCCACTTGGAAGCCCAGACAAGG - Intronic
914534710 1:148554909-148554931 TCCACTTGGAAGCCCAGACAAGG - Intronic
914535246 1:148559622-148559644 TCCACTTGGAAGCCCAGACAAGG - Intronic
914535782 1:148564368-148564390 TCCACTTGGAAGCCCAGACAAGG - Intronic
914536317 1:148569084-148569106 TCCACTTGGAAGCCCAGACAAGG - Intronic
914537214 1:148577012-148577034 TCCACTTGGAAGCCCAGACAAGG - Intronic
914586129 1:149063462-149063484 TCCACTTGGAAGCCCAGACAAGG - Intronic
916823646 1:168424271-168424293 TTCCTTTTGAAGCCAAGTCAGGG - Intergenic
918497824 1:185159023-185159045 TTCCCTTGCGAGCCTTTCCATGG + Intronic
919774234 1:201183828-201183850 GTCCTTGGGAAGCCCAGCCATGG - Intergenic
919817941 1:201453475-201453497 TTCTTTGGGAAGCCTTGCCAGGG - Intergenic
921183815 1:212653098-212653120 TTGCCTTGGAAGCCCAGTCTGGG + Intergenic
921628303 1:217402785-217402807 TTCACTTGGCAGCCCAGGCAGGG - Intergenic
922706631 1:227793898-227793920 ATCCCTGGGAAGCCAGGCCATGG + Intergenic
922917333 1:229269938-229269960 GTCACTTGGGAGCTTAGCCAAGG + Intergenic
923542286 1:234897282-234897304 TTCCGTGGGAAGCGAAGCCAAGG + Intergenic
1063849196 10:10164824-10164846 TTCTCTTGGAAGGCAGGCCAGGG + Intergenic
1068627399 10:59264156-59264178 TTCCCTTGGTAGCCTTCACATGG - Exonic
1069903915 10:71721150-71721172 TGCCCTTGCATGCCTATCCATGG - Intronic
1069919003 10:71805137-71805159 TTCCCTGGGCAGCCTTGTCATGG + Intronic
1070617496 10:77980063-77980085 TTCCCTTGGAAGCCTAGCCATGG + Intronic
1070845775 10:79521863-79521885 GTCCCTTGGAGGCTTGGCCAGGG + Intergenic
1070928018 10:80238455-80238477 GTCCCTTGGAGGCTTGGCCAGGG - Intergenic
1073451444 10:103611826-103611848 ATCCCCTGGAAGCACAGCCAAGG - Intronic
1074218181 10:111408749-111408771 CTCCCTTGGCACCCTAGGCAAGG + Intergenic
1074698258 10:116070479-116070501 TTCCGTTGTAAGACAAGCCATGG + Intronic
1074895424 10:117773264-117773286 TTCCCATGGAAGCATGGGCACGG - Intergenic
1075075212 10:119346040-119346062 TTCCCAAGGAACCCTTGCCATGG + Intronic
1075936964 10:126351065-126351087 TTCGCTTGAAATCCTGGCCATGG - Intronic
1076745672 10:132512335-132512357 TTCCCTTGGATTCATACCCAAGG - Intergenic
1079356634 11:19735362-19735384 TTCCCTTGGCATCCTAGGCAGGG + Intronic
1079453148 11:20614944-20614966 TGCTCTTGGAAGCCAAACCAGGG - Intronic
1079946771 11:26753016-26753038 TTCCCTTAGAAGCCTCTCAAGGG - Intergenic
1080481441 11:32655099-32655121 TTCCCTTGCAAGATTAGCCAAGG + Intronic
1081941465 11:46945951-46945973 TTCCCTTGGTAGCCTAGTTCTGG + Intronic
1083871553 11:65491258-65491280 TTCTCCTGGAAGCTTATCCAAGG - Intergenic
1084423614 11:69072561-69072583 CTCCCTTGGAACCCTGGCCTGGG - Intronic
1089009126 11:115118642-115118664 TTCCCTTGGGAGCTGAGCCCAGG - Intergenic
1089880976 11:121773358-121773380 TTCCCTTGGAAGCATTAGCAGGG + Intergenic
1090394125 11:126407757-126407779 TTCTCATGGTAGCCTAGCCTGGG + Intronic
1091253228 11:134161574-134161596 TTCCCTTGGATGTGCAGCCAGGG - Intronic
1092016955 12:5167514-5167536 TTTCCTTGGAATCCGAGCGAAGG + Intergenic
1092313281 12:7382578-7382600 GGCCCTTGCAATCCTAGCCATGG + Intronic
1097020293 12:56016008-56016030 TTCCCTAGGAAGCCAGGGCATGG - Intronic
1098639215 12:72819483-72819505 TTCCGTGGGAAGCATAGACAGGG + Intergenic
1100556996 12:95704827-95704849 TTCCTAGGGAAGCCTACCCAGGG + Intronic
1101776242 12:107796795-107796817 TTTCCTTGGCTGCCTTGCCAGGG - Intergenic
1102770195 12:115469480-115469502 TTCCCTAGGAAGCCATGCGATGG - Intergenic
1104775874 12:131389831-131389853 TTCCATGGGAAGCAGAGCCAGGG - Intergenic
1107115935 13:36745503-36745525 TTCCTGGGGAATCCTAGCCAGGG + Intergenic
1109388747 13:61666860-61666882 CTCCCTCAGAAGCCTATCCAAGG + Intergenic
1114899156 14:27034309-27034331 TGCCTTTGGGAGCCTTGCCATGG + Intergenic
1115859873 14:37672483-37672505 TTCTCTTGGATTCCTAGCCCTGG + Intronic
1118957660 14:70497571-70497593 TTCCCTTGGGAGCTTTGCCAAGG - Intergenic
1120928144 14:89819016-89819038 TTCCCTTGGATACGTAGCTAGGG - Intronic
1122409329 14:101517986-101518008 TTCCCTCGGAATCCAAGCGACGG + Intergenic
1122960128 14:105090435-105090457 TGCCCATGGAAGCCCTGCCAAGG + Intergenic
1125074781 15:35601595-35601617 TTCCCTTGGTATCATAGTCAGGG + Intergenic
1128925177 15:71648775-71648797 GTCCCTTGGCAGTCTGGCCATGG - Intronic
1129913324 15:79245968-79245990 TTCACCTGGAAGCCTGACCATGG + Intergenic
1132179100 15:99738256-99738278 CTCCCTTGGAGCCCTAGCAAGGG + Intergenic
1135189395 16:20342575-20342597 TTCCCTTCGAAGCTTGCCCATGG - Intronic
1139277423 16:65740891-65740913 TGCCCCTGGAAGCCAAGCCAGGG + Intergenic
1141679442 16:85535738-85535760 TTCCCATTGGCGCCTAGCCAGGG - Intergenic
1141754242 16:85980620-85980642 TTCCCATGGAAGACTTGCAAAGG + Intergenic
1142611679 17:1111875-1111897 CTCACTTGGAAGCCCAGCCACGG + Intronic
1148635706 17:49147748-49147770 TTCCCTTGTAAACCTAGCTAAGG + Intronic
1148819732 17:50353662-50353684 TGTCCTTGGAACCCTCGCCAGGG - Exonic
1152726748 17:81950902-81950924 TGCCCTTGGAAGCAGAGCCAGGG + Intergenic
1156698422 18:39795585-39795607 TTCCCTTAGAGGCCTATCTAAGG + Intergenic
1157151551 18:45223606-45223628 TAGCCATGGAAGCCTAGCCAGGG - Intronic
1159431819 18:68362394-68362416 CTCCCTTGGAGGCCTATCTAAGG - Intergenic
1159636952 18:70816642-70816664 CTCCCCTGGAAGCCTGGCAAGGG - Intergenic
1160422514 18:78756749-78756771 TTTCTCTGGAAGCCTCGCCAGGG - Intergenic
1162963404 19:14142595-14142617 TTTGCTTGGAAGCGTAGGCATGG - Intergenic
1163003698 19:14384381-14384403 TTCCCCTGGAAGCCCCTCCAGGG + Intronic
1164136580 19:22422194-22422216 ACCCCTTGGAAGCCTAGAAATGG - Exonic
1164226454 19:23250239-23250261 CTCCCCTGGAAGCCTAGAAATGG - Exonic
1165777738 19:38414806-38414828 TACCCTTGGAAGCCCAGCCTGGG + Intronic
1202676397 1_KI270711v1_random:10740-10762 TCCACTTGGAAGCCCAGGCAAGG - Intergenic
929091945 2:38226404-38226426 TTCACTTGGAAGGCAAGGCAAGG - Intergenic
932490252 2:72115716-72115738 CTCCCTTCGAAGCCTGGCCCTGG + Intergenic
935785359 2:106544021-106544043 TCCCCATGGATGCCTAGCAAGGG + Intergenic
936936146 2:117840004-117840026 TTCCCCTGGATGCCAAGCGATGG + Intergenic
938164018 2:129010421-129010443 TAGCCGTGGAAGCCTGGCCAGGG + Intergenic
1172153836 20:32809955-32809977 TTCCCTTGGAGGGCTTGTCAGGG + Intergenic
1173364441 20:42372157-42372179 TTCACTTGGAAACATAGCCAAGG - Intronic
1175596989 20:60243179-60243201 TGCCCTTGGATTCCTAGCCTTGG + Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176256190 20:64154401-64154423 CTCCCTTTGAAGCCTAGCAGGGG + Intronic
1180159248 21:45991792-45991814 TTCCCTGTGAGGCCCAGCCAAGG - Intronic
1180195075 21:46189249-46189271 GTCCCTGGGACTCCTAGCCATGG - Exonic
1181557579 22:23680527-23680549 TTCCCTTGGAAACCTGGAAAAGG - Intergenic
1183098759 22:35570590-35570612 TTCCCCAGGAGGCCTCGCCAGGG - Intergenic
949887871 3:8710745-8710767 TTCCTCTGGAAACCTATCCAAGG + Intronic
954612568 3:51953792-51953814 TTCCCTCTGAAGCTCAGCCAGGG - Intergenic
957391081 3:79570330-79570352 CTCTCTTGGAAGCCTAAGCAGGG - Intronic
967156919 3:186701544-186701566 TGCCCTTGGGAGCACAGCCAAGG + Intergenic
967682888 3:192385743-192385765 TGCCCTTGGAAGTACAGCCAAGG + Intronic
969365903 4:6694202-6694224 ATGCCCTGGAAGCCCAGCCAAGG + Intronic
971017989 4:22508286-22508308 TTGCCTTGGAAGCCCAGTCTGGG - Intronic
971507730 4:27384618-27384640 TTCAAAAGGAAGCCTAGCCAAGG + Intergenic
972730640 4:41791450-41791472 TTCCATTGGAAACGTAGTCAAGG + Intergenic
982574621 4:157093790-157093812 ATCCCTTGAAAGCAGAGCCAAGG - Intronic
983477263 4:168229398-168229420 TTCCATTGGCAGCCTTCCCAAGG - Intronic
988263776 5:28926402-28926424 CTCCCCTGGAGGCCTAGCCTGGG - Intergenic
989381257 5:40811499-40811521 TTACCTTGGTTGCCTAGCTAAGG + Intergenic
991599277 5:68336366-68336388 CTCCCTTGGCAGCCTTCCCAGGG - Intergenic
991982023 5:72242181-72242203 TTGCCTAGGAAGCCAAACCACGG + Intronic
997090187 5:130847295-130847317 TTCCCTTGAAAACCTTTCCAGGG - Intergenic
998121035 5:139578007-139578029 TTTCCTTTGAAGCCTAGTGAGGG + Intronic
1000288374 5:159847180-159847202 AGCCCTTGGAAGCCAAGCCAAGG + Intergenic
1000413674 5:160960784-160960806 TTTTCTTTGAATCCTAGCCATGG - Intergenic
1003217776 6:4130766-4130788 TGCCCTTGGCAGCCTGCCCAAGG - Exonic
1004481757 6:16026109-16026131 TCCCCTTGAAATTCTAGCCAAGG - Intergenic
1006258082 6:32846918-32846940 TTCCATTGGATGCCTCCCCAAGG - Intronic
1006576914 6:35053287-35053309 TTCCCCAGGAAACCTGGCCAGGG - Intronic
1006981845 6:38153756-38153778 TTCCCTTGAAAGCCCAGGCAGGG + Exonic
1007815930 6:44525557-44525579 TTCCAGTGGAAGCCAGGCCAGGG - Intergenic
1013237973 6:108215578-108215600 TCCCCTTCAAAGCCTAACCAAGG + Intronic
1018170450 6:161139679-161139701 TTCCCTTGGAAGCAGGGCCTCGG - Intronic
1018594153 6:165460341-165460363 TTCCCTGGAAAGCAGAGCCAGGG + Intronic
1018707198 6:166471432-166471454 TTACCCTGGAAGCTTGGCCAGGG + Intronic
1019201045 6:170315534-170315556 TTATCTTGGAAACATAGCCAAGG - Intronic
1019359203 7:596084-596106 TTCCCAGGGACGCCTGGCCAAGG + Intronic
1020665501 7:11036482-11036504 TTCCCTTGGAACCCAGGCCTGGG - Exonic
1022870891 7:34478598-34478620 TTCCCTTGGACATTTAGCCAAGG - Intergenic
1023668103 7:42546570-42546592 TTACTTTGGGACCCTAGCCATGG + Intergenic
1024564658 7:50671620-50671642 TTCAGTTGGACGCCTTGCCAAGG - Intronic
1026036182 7:66832151-66832173 ATCCCAGGGAAGCCAAGCCAGGG + Intergenic
1026983317 7:74538988-74539010 ATCCCAGGGAAGCCAAGCCAGGG - Intronic
1027214419 7:76174592-76174614 ATCCCAGGGAAGCCAAGCCAGGG - Intergenic
1030073254 7:105715482-105715504 TTCCTTTGGCTGCCAAGCCAAGG + Intronic
1033552522 7:142460521-142460543 CTCCCTGTGAAGCCTAGCTATGG - Intergenic
1040498335 8:47986406-47986428 CATCCTAGGAAGCCTAGCCAAGG - Intergenic
1042038756 8:64568393-64568415 TTCCTTTGCAAACCTATCCATGG + Intergenic
1044503514 8:92990771-92990793 TTCCCTTGGGTGCCTAGGCCAGG + Intronic
1046038376 8:108872759-108872781 TTATCTTGCAAACCTAGCCAAGG + Intergenic
1052508442 9:29383511-29383533 TTCCGTGGGAAGCATAGACAGGG - Intergenic
1053382484 9:37660264-37660286 GACCCTTGGGAGCCTAGCAAGGG + Intronic
1055297846 9:74852527-74852549 CTCCCTCTGATGCCTAGCCAAGG + Intronic
1061489545 9:130937706-130937728 GTCCCTTGGCAGCCCAGCCTGGG + Intronic
1192761146 X:74097804-74097826 TTCCCTCTGATGCCAAGCCAAGG + Intergenic
1193728741 X:85076675-85076697 TTACCTAGTGAGCCTAGCCATGG + Intronic
1199621749 X:149707404-149707426 TTCATTTGGAAGCCTACCAAAGG - Intronic