ID: 1070618247

View in Genome Browser
Species Human (GRCh38)
Location 10:77986042-77986064
Sequence GGGGTTCTAACGCGTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070618240_1070618247 18 Left 1070618240 10:77986001-77986023 CCAAGCACAGAGTTAGGGCCAGC 0: 1
1: 0
2: 1
3: 24
4: 169
Right 1070618247 10:77986042-77986064 GGGGTTCTAACGCGTCTTGGAGG 0: 1
1: 0
2: 0
3: 1
4: 29
1070618242_1070618247 0 Left 1070618242 10:77986019-77986041 CCAGCGGCAACTACAAACAGCTC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1070618247 10:77986042-77986064 GGGGTTCTAACGCGTCTTGGAGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070618247 Original CRISPR GGGGTTCTAACGCGTCTTGG AGG Intronic
918858974 1:189796899-189796921 GGGGTTTTAAAGTGTATTGGTGG + Intergenic
1064003238 10:11680878-11680900 GGTGTTTTAAGGCTTCTTGGAGG - Intergenic
1070618247 10:77986042-77986064 GGGGTTCTAACGCGTCTTGGAGG + Intronic
1080857645 11:36126142-36126164 GGGGTTCTAACGCTTCCTGCGGG - Intronic
1096600014 12:52722453-52722475 TGGGTTCTAAGGGGCCTTGGAGG + Intergenic
1098132574 12:67365808-67365830 GGGACTCTAAGGCTTCTTGGAGG + Intergenic
1104357104 12:128096853-128096875 GATGTTCTAACGCCTCTTGAGGG + Intergenic
1104963163 12:132497737-132497759 GGGGATCTAACCCTTCTTAGTGG + Intronic
1114629626 14:24150781-24150803 GGGGCACTAAGGCGTCGTGGGGG - Exonic
1132203392 15:99970330-99970352 AGGGTTCTAACACCTCCTGGAGG + Intergenic
928317575 2:30257954-30257976 GGGATTCCAATGGGTCTTGGTGG + Exonic
1169612440 20:7397125-7397147 GGGGTTCTATCAAGACTTGGAGG + Intergenic
1171521767 20:25781589-25781611 GGGCTTCTAACACATCTTGTAGG - Intronic
1171555074 20:26074462-26074484 GGGCTTCTAACACATCTTGTAGG + Intergenic
1172639704 20:36433323-36433345 GGGGTCCTAACCCAGCTTGGGGG + Intronic
1182338673 22:29602456-29602478 AGGGTTCTAACGGGTGTAGGGGG - Intergenic
950875038 3:16264335-16264357 GGGGTTCTCACCCACCTTGGGGG - Intronic
952723422 3:36557030-36557052 AGGGTTCTAACTGGTGTTGGGGG + Intergenic
953688596 3:45098031-45098053 GGGCTTCTAACACGGCTTTGGGG - Intronic
958163740 3:89852218-89852240 GGGGTTCTATGGCCACTTGGTGG - Intergenic
961053989 3:123770990-123771012 GGGGTTGTAAGGCATCTTAGAGG - Intronic
974509074 4:62813731-62813753 GGGGCTCCAACTCTTCTTGGTGG + Intergenic
985782688 5:1879420-1879442 GCGGTTCTAGGACGTCTTGGGGG - Intronic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1017451608 6:154559330-154559352 GGGTGTCTAACGTGGCTTGGTGG - Intergenic
1018083485 6:160278804-160278826 GGGGTTCTTAGGCTTCTGGGTGG - Intergenic
1025282215 7:57636367-57636389 GGGCATCTAACACATCTTGGGGG - Intergenic
1025302515 7:57829152-57829174 GGGCATCTAACACATCTTGGGGG + Intergenic
1027390963 7:77703058-77703080 AGGGTTCTAGCGCTTCATGGGGG + Intronic
1040495443 8:47961203-47961225 GGGGGACTCACGCGTCTGGGCGG - Exonic
1047864437 8:129006254-129006276 GGGCTTCTAATGACTCTTGGGGG + Intergenic