ID: 1070618963

View in Genome Browser
Species Human (GRCh38)
Location 10:77991986-77992008
Sequence GACCATTTCTAGAGGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070618960_1070618963 21 Left 1070618960 10:77991942-77991964 CCTTTACTGTAAGCAGCGTAGAA 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1070618963 10:77991986-77992008 GACCATTTCTAGAGGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070618963 Original CRISPR GACCATTTCTAGAGGACAAA AGG Intronic
No off target data available for this crispr