ID: 1070624114

View in Genome Browser
Species Human (GRCh38)
Location 10:78036954-78036976
Sequence CATTCTCTCAACAGGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070624114_1070624118 5 Left 1070624114 10:78036954-78036976 CCAAACTCCCTGTTGAGAGAATG 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1070624118 10:78036982-78037004 TGGACCATTTGTTTCCTGTGAGG 0: 1
1: 0
2: 2
3: 40
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070624114 Original CRISPR CATTCTCTCAACAGGGAGTT TGG (reversed) Intronic
902067953 1:13704804-13704826 CATTCTCTTAACAAGGTCTTGGG - Intronic
904133357 1:28291817-28291839 CATCGTCTCATCAGAGAGTTCGG + Intergenic
907948491 1:59157425-59157447 CAGTCTCTCACCAGGGATTCAGG - Intergenic
909211379 1:72829191-72829213 CATTTTCTGAAGAGGGAGCTGGG - Intergenic
909302103 1:74025789-74025811 CATACTCCAAACAGGGATTTAGG + Intergenic
909880523 1:80870909-80870931 CTTTCTCTCAAGAGAGACTTTGG + Intergenic
910758905 1:90717030-90717052 CAATCTCCGAACAGGGAGATGGG + Exonic
914716116 1:150256696-150256718 CATTCTCTAACGAGGGATTTAGG + Intergenic
915639278 1:157209746-157209768 CTTTCTCTTAGCAGGGAGCTGGG + Intergenic
917669920 1:177263735-177263757 CTTTCTATTAACAGGGAGGTAGG + Intronic
919057394 1:192588177-192588199 CATTCTTCCCACATGGAGTTAGG + Intergenic
920126974 1:203701048-203701070 CTTTATCTCAGCAAGGAGTTTGG - Intronic
920571089 1:207018432-207018454 CTTTCTCTCAGAAGTGAGTTGGG + Intronic
921803506 1:219429121-219429143 CATTCTCTTACCAAAGAGTTTGG - Intergenic
923539314 1:234876765-234876787 CATTCACTAACCTGGGAGTTTGG + Intergenic
1063619336 10:7631357-7631379 TCTTCTCTCAACGTGGAGTTGGG + Intronic
1066274915 10:33859333-33859355 CATTCTGTCAGCAGGTAATTTGG - Intergenic
1068144401 10:53048724-53048746 CTCTCTCTCAACAGGCAGTATGG - Intergenic
1070070855 10:73087867-73087889 TATTCTCTCAACAGTGTGTTTGG + Intronic
1070624114 10:78036954-78036976 CATTCTCTCAACAGGGAGTTTGG - Intronic
1071489066 10:86123679-86123701 CTTTCTTTCAGCAGGGAATTCGG - Intronic
1071714470 10:88081498-88081520 CATTCTTTCAGCAGGGACTGTGG - Intergenic
1074109746 10:110414512-110414534 CAATTTTTGAACAGGGAGTTTGG + Intergenic
1078185393 11:9047652-9047674 CATTCGGTCCACAGGGAGCTCGG - Intronic
1080610423 11:33899455-33899477 TGTTCTCTCAGCAGTGAGTTGGG - Intergenic
1080771309 11:35344702-35344724 CATTGTCTGAAGAGGGAGGTTGG - Intronic
1081170074 11:39857335-39857357 CATTCTCTTAACAAGGGGTTAGG - Intergenic
1081828194 11:46079643-46079665 TCTTCTCTCAAGAAGGAGTTCGG + Intronic
1084054514 11:66623947-66623969 TCTTCTCTCACCAGGAAGTTGGG + Intronic
1084176793 11:67426715-67426737 CATTCTGTCAACAGCGTTTTTGG + Intergenic
1084313688 11:68331505-68331527 TCTTCCCTCAACAGGGAGATGGG - Intronic
1084492746 11:69487420-69487442 CATTTTCTCATCTGTGAGTTGGG + Intergenic
1087222213 11:95558737-95558759 CACTCTCTTACCATGGAGTTTGG - Intergenic
1087455172 11:98375930-98375952 CATTCTCTAAACATAGTGTTAGG - Intergenic
1089845409 11:121454262-121454284 CATTCTGGGAACTGGGAGTTGGG + Intronic
1091290900 11:134439268-134439290 CCATCCATCAACAGGGAGTTGGG - Intergenic
1096757600 12:53813089-53813111 CAATCTCTCATCAGGGAGGTAGG - Intergenic
1097671525 12:62544910-62544932 CATTCTCTCATTCGAGAGTTTGG - Exonic
1099598841 12:84704932-84704954 CATTTTCTGAATATGGAGTTTGG + Intergenic
1100934156 12:99644310-99644332 CATTCTCTCTACAATGATTTAGG + Intronic
1103024380 12:117561895-117561917 CATTCATTCAACACTGAGTTTGG + Intronic
1104318242 12:127723925-127723947 CATTCCCCAAACAGGGAATTTGG + Intergenic
1109095392 13:58107650-58107672 AATTCTCTCCACAGGGGGTAGGG + Intergenic
1110646312 13:77888953-77888975 CACTCACACAACATGGAGTTTGG - Intergenic
1113608694 13:111628093-111628115 CACTCTCTCAGCAGGTAGCTTGG + Intronic
1113692016 13:112317804-112317826 CATTCTCTCAGCATGGAGCCAGG + Intergenic
1113761986 13:112854618-112854640 CATTGTCTCTACTGGGAATTCGG + Intronic
1114331091 14:21637840-21637862 CTTTCTTTCAACAGGGAGCCTGG - Intergenic
1122476663 14:102014742-102014764 CATTCTCTCTACAGGAATCTGGG - Intronic
1123785442 15:23666894-23666916 TATTCTCTTAACAGTGACTTCGG + Intergenic
1126733792 15:51711445-51711467 CATTCACTCATTAGGTAGTTAGG - Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1132036003 15:98485433-98485455 CATTCACACAACTGGGGGTTAGG - Intronic
1132789020 16:1674669-1674691 CGTACTCTTAACAGGGAGTGGGG + Exonic
1135308298 16:21385793-21385815 CTGTCTTTGAACAGGGAGTTTGG + Intergenic
1136305042 16:29364920-29364942 CTGTCTTTGAACAGGGAGTTTGG + Intergenic
1136427633 16:30179875-30179897 CCCTCTCTCCACTGGGAGTTAGG - Intergenic
1137282753 16:46992379-46992401 CCTGCTCTGATCAGGGAGTTGGG - Intergenic
1140513927 16:75529028-75529050 CCTACTATCAACCGGGAGTTTGG - Exonic
1140899721 16:79356620-79356642 CATTCACTCCACAGGGCCTTTGG + Intergenic
1141149680 16:81555420-81555442 CATGCTCTCAGCAGGGAATGGGG + Intronic
1141239875 16:82255785-82255807 CATTCTCATAACAGAGAATTTGG - Intergenic
1142522444 17:514632-514654 CATTCTTTCAACAGGGAACCAGG + Exonic
1144834373 17:18149202-18149224 CCTTTTCTCCACAGGGTGTTTGG + Exonic
1146007100 17:29167366-29167388 CATTCTCTCACCAGGAGGTCAGG - Intronic
1151713243 17:75818473-75818495 CATGCTCTCAACAAGGTGTCGGG + Intronic
1153582532 18:6589008-6589030 CAGTCACTGAACATGGAGTTGGG + Intronic
1155412684 18:25563726-25563748 CATTTTCTGAACAGGAAGTAGGG + Intergenic
1155998563 18:32358682-32358704 CATTCCCTCACGAGGGAATTTGG - Intronic
1156681093 18:39589773-39589795 CAGGATATCAACAGGGAGTTTGG + Intergenic
1159135559 18:64332893-64332915 CATTCACTAAAGAGGCAGTTAGG + Intergenic
1160613048 18:80103996-80104018 CATTCTCTCATTGGAGAGTTTGG - Intergenic
1161126228 19:2559524-2559546 TTTTCTCTCAAGATGGAGTTTGG + Intronic
1167206944 19:48108970-48108992 CAATCTCTCAACAAGGACTGGGG + Intronic
926022074 2:9505138-9505160 GAGTCTCTCCACAGGGATTTTGG - Intronic
926059938 2:9798945-9798967 CATCATCTCCCCAGGGAGTTCGG + Intergenic
936780202 2:116023386-116023408 CTTTCTCTCATCAGGAATTTGGG + Intergenic
941776363 2:169397804-169397826 CATTCTCTCCGGAGAGAGTTAGG - Intergenic
943817642 2:192276870-192276892 CCTTGTCTCAAAAGGGACTTTGG - Intergenic
947899883 2:233712464-233712486 CTTTCTTTAAACAGGGAGTGGGG - Intronic
1170417283 20:16158056-16158078 CATTCTCTCAACTGAGGTTTCGG + Intergenic
1171333449 20:24361438-24361460 CATCCTCACAGCAGGGTGTTTGG + Intergenic
1172890368 20:38260119-38260141 CATTGTCCCGGCAGGGAGTTTGG - Intronic
1172897709 20:38312201-38312223 CATTTTCTCAGCAGGGAGGAAGG - Intronic
1172928657 20:38565011-38565033 CAGTCCCTCAGAAGGGAGTTGGG - Intronic
1173124614 20:40325216-40325238 CCTTCACTCAAGAGGGAGTATGG - Intergenic
1173733553 20:45344543-45344565 ACTTCTCCCAACAGGGAGATGGG + Intronic
1176230923 20:64032537-64032559 CCTTCTCCAAACAAGGAGTTAGG - Intronic
1178384373 21:32137519-32137541 CATTCTCTCAACAGTTACTTAGG + Intergenic
1181484899 22:23224453-23224475 CATTCTCTCAGCAGGGTGGTGGG + Intronic
1181807892 22:25386080-25386102 TCTTCACTCAACAGGGAGATGGG + Intronic
1182586779 22:31347891-31347913 CATTCTCTCCAACAGGAGTTTGG - Intergenic
1182780120 22:32860800-32860822 CATTCACCCACCAGGGAGCTAGG - Exonic
1182970374 22:34568243-34568265 CATTGAATCAACAGGAAGTTAGG + Intergenic
1184630261 22:45772034-45772056 CATTCTCTTAGCAGTGTGTTTGG + Intronic
1184638388 22:45854562-45854584 CATACTAGCAACAGAGAGTTGGG + Intergenic
949628593 3:5896085-5896107 CATTCTTTCATCAGGCATTTAGG + Intergenic
950708418 3:14798069-14798091 AATGCTCTCAGCAGGGAGTGAGG - Intergenic
951090569 3:18568726-18568748 CTTTTCCTCAAAAGGGAGTTTGG - Intergenic
953913183 3:46903111-46903133 CATCCTCACAACAGGGTGTTTGG - Intronic
955618440 3:60834556-60834578 CATTCTCTTAAAAGGGTCTTAGG + Intronic
957148246 3:76452088-76452110 TATTCTCTCAACAAAGAATTAGG - Intronic
957172660 3:76758644-76758666 CATTTTCCCAACAGAGAGGTGGG - Intronic
957689238 3:83546016-83546038 CCTTCTCTCCTCATGGAGTTGGG + Intergenic
957694697 3:83619780-83619802 CCTGCTCTCAACAGGGAGAATGG - Intergenic
966683866 3:182672375-182672397 CATTCTCTAGAAAGGGAGCTTGG - Intergenic
968063613 3:195745981-195746003 GATTCTCTCTTCAGGGATTTGGG + Intergenic
972740981 4:41885831-41885853 CATTTTCTCAAAGGTGAGTTTGG + Intergenic
975021969 4:69501623-69501645 GAGTCTCCCAACAGGGATTTTGG + Intronic
976189406 4:82474328-82474350 CATGATCTTAACTGGGAGTTCGG - Intergenic
977143201 4:93401767-93401789 CATTCTCTCAATAGATATTTTGG - Intronic
977297459 4:95226782-95226804 CAATTTCTCAAGAGGGTGTTTGG + Intronic
977509465 4:97943999-97944021 CCTTCTTTCAACAGGAATTTTGG - Exonic
979943388 4:126792433-126792455 CTTTTTCTCAATAGGCAGTTCGG + Intergenic
984312237 4:178076947-178076969 CATTCTCTCAACACTGTGCTAGG - Intergenic
985657694 5:1140554-1140576 CATTCTGTAAACAGGGAGATGGG + Intergenic
992994720 5:82321379-82321401 GGTTCTCTCACCAGGGATTTTGG + Intronic
1001106505 5:168858949-168858971 CCTTCTCTAAACAGAGAGTGAGG + Intronic
1005619374 6:27605864-27605886 CATTCTGTAATCAGTGAGTTCGG - Intergenic
1006273982 6:32986498-32986520 CAATGGCTGAACAGGGAGTTGGG - Intergenic
1007188516 6:39993925-39993947 CATCCTCTGAAAAGGGAGTCTGG + Intergenic
1008310767 6:49970214-49970236 CATTCTCTCAACTGTATGTTGGG + Intergenic
1016654734 6:146505463-146505485 CATTTACTCTACAGGGGGTTGGG - Intergenic
1023403612 7:39809157-39809179 AATTCTATCAACAGAGATTTTGG - Intergenic
1024278906 7:47701958-47701980 CACTCTCCCAACAGTGGGTTTGG + Intronic
1026279785 7:68912050-68912072 CATGCTGTCATCAGGGAGCTGGG - Intergenic
1031967715 7:128039735-128039757 CATTTTCTCCAAAGGGAGTGGGG + Intronic
1032272661 7:130424884-130424906 CATCCTCTTAACAGGGTCTTTGG - Intronic
1038883287 8:31638197-31638219 CATTCTCTCAAAGTGCAGTTTGG - Intergenic
1040077492 8:43252356-43252378 GATTCTCTTAATAGGCAGTTGGG - Intergenic
1040705078 8:50115878-50115900 AATTCTCTCCACTGGGGGTTGGG - Intronic
1042299177 8:67257976-67257998 AATTCTCTAAACAGGGGATTAGG + Intronic
1043521309 8:81048426-81048448 CCTTCTCTCTGCAGGGAGTAGGG + Intronic
1046497961 8:115038444-115038466 CATTTTCTCACCAGTGAGATGGG + Intergenic
1047585600 8:126268743-126268765 CAGTCTCCCAGGAGGGAGTTAGG + Intergenic
1054731006 9:68703162-68703184 AACTCTATCAACAGGGATTTAGG - Intergenic
1057839011 9:98470068-98470090 CATTCTCTCTAGAGGGTGTGGGG - Intronic
1060143033 9:121226848-121226870 CATTCTCTAAAGAGGGAGAAGGG + Intronic
1062054058 9:134461781-134461803 CATCCTCTCAACATGGAGGCTGG + Intergenic
1187804904 X:23108675-23108697 CATTCTCTTAACAGTGTTTTTGG + Intergenic
1189471635 X:41319218-41319240 CATCCTCTTAACAGGGTCTTTGG + Intergenic
1189662536 X:43317388-43317410 CATTCTCTAAACTGGGAGACAGG - Intergenic
1195018454 X:100801122-100801144 CTTGCTCTCCACTGGGAGTTGGG - Intergenic
1195098790 X:101532932-101532954 TATTCTCCCAACAGGGAGGCAGG - Intronic
1197053611 X:122091603-122091625 CACTCACTCTACAGAGAGTTTGG - Intergenic