ID: 1070626466

View in Genome Browser
Species Human (GRCh38)
Location 10:78054514-78054536
Sequence CCTCATCTGCAAAAGCGGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 2, 2: 5, 3: 69, 4: 439}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070626466_1070626474 -9 Left 1070626466 10:78054514-78054536 CCTTCCCGCTTTTGCAGATGAGG 0: 1
1: 2
2: 5
3: 69
4: 439
Right 1070626474 10:78054528-78054550 CAGATGAGGGAATTGGGGCTTGG 0: 1
1: 1
2: 20
3: 222
4: 1239
1070626466_1070626475 5 Left 1070626466 10:78054514-78054536 CCTTCCCGCTTTTGCAGATGAGG 0: 1
1: 2
2: 5
3: 69
4: 439
Right 1070626475 10:78054542-78054564 GGGGCTTGGAGTGCAAGCATTGG 0: 1
1: 0
2: 0
3: 13
4: 184
1070626466_1070626476 6 Left 1070626466 10:78054514-78054536 CCTTCCCGCTTTTGCAGATGAGG 0: 1
1: 2
2: 5
3: 69
4: 439
Right 1070626476 10:78054543-78054565 GGGCTTGGAGTGCAAGCATTGGG 0: 1
1: 0
2: 0
3: 9
4: 135
1070626466_1070626477 20 Left 1070626466 10:78054514-78054536 CCTTCCCGCTTTTGCAGATGAGG 0: 1
1: 2
2: 5
3: 69
4: 439
Right 1070626477 10:78054557-78054579 AGCATTGGGAAGAATTTCCCAGG 0: 1
1: 0
2: 2
3: 21
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070626466 Original CRISPR CCTCATCTGCAAAAGCGGGA AGG (reversed) Exonic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900457602 1:2785124-2785146 CCTCCTCTCCCAAAGGGGGATGG - Intronic
900555419 1:3278003-3278025 TCTCATCTGAAAAGGAGGGAGGG + Intronic
900628478 1:3620922-3620944 CCTCAGCTGCCAAACGGGGAAGG - Intergenic
900764670 1:4496001-4496023 CATCAACTGCAAAAGACGGAAGG - Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902657397 1:17878798-17878820 CCTCATCTGTAAAATAGGAAGGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903212930 1:21828802-21828824 CCTCCTCGGGACAAGCGGGAGGG - Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903808915 1:26023546-26023568 CCTCAGCTGCAGCAGCAGGAGGG + Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
904624442 1:31794115-31794137 CCACATCTGCAAGGGTGGGAGGG - Exonic
904882927 1:33714390-33714412 CCTTATCTGCAAAATAGGGATGG - Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905210844 1:36373148-36373170 CCTCATCTGTAAAACAGAGATGG + Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
907257350 1:53190045-53190067 CCTTATCTGTAAAAGGGAGATGG - Intergenic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
910454943 1:87387574-87387596 CATCATCTGCAAAACAGAGATGG + Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911739950 1:101376287-101376309 CCTTATCTGCAAATCAGGGAGGG + Intergenic
912382673 1:109255749-109255771 CCTCAGGTGCAAAGGCAGGATGG - Intronic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
913671141 1:121097959-121097981 CCTCACCGTCAAAAGCAGGAAGG + Intergenic
914022908 1:143885380-143885402 CCTCACCGTCAAAAGCAGGAAGG + Intergenic
914661395 1:149793324-149793346 CCTCACCGTCAAAAGCAGGAAGG + Intronic
914887493 1:151597372-151597394 CCTCATCTGCAAACTTCGGAGGG + Intergenic
915471549 1:156128732-156128754 CCTCATCTATAAAAGGGAGAGGG + Intronic
915545907 1:156597671-156597693 CCACATCTGCAAAGCAGGGATGG + Intronic
915902056 1:159854567-159854589 CCTCCTCCCCAAAAGTGGGAAGG - Exonic
915954251 1:160209629-160209651 CCTCAGCTGGAAAAGGGGGCAGG - Intronic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
917523028 1:175763584-175763606 CCTCAACTGCCAATGTGGGATGG - Intergenic
918304154 1:183230610-183230632 CCTCATCTGCAAAATAGAGGGGG + Intronic
918316280 1:183325130-183325152 CCTGATCTGCTGAAGTGGGAAGG + Intronic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
918627492 1:186674490-186674512 TCTCATCTGCAATAACGTGAAGG - Exonic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920562176 1:206946741-206946763 TTTCATCTGGAAAAGAGGGATGG + Intergenic
921075306 1:211695841-211695863 CCTCATCTGTAAAATAGAGATGG - Intergenic
922656506 1:227389116-227389138 CCTCATCCACAAAAGCAGGATGG + Intergenic
923220648 1:231889578-231889600 CCTCAACTGTAAAACTGGGAAGG - Intronic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923883360 1:238128431-238128453 ACTTTTCTGCAAAAGCAGGAAGG - Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924290280 1:242529456-242529478 CCTCATCTGTAACATAGGGATGG - Intergenic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1069831647 10:71285534-71285556 TCTCATCTGCGAAAGGGGCAGGG - Intronic
1069894430 10:71671817-71671839 CCTCACTTGCAAAAGTGGGTGGG + Intronic
1069941194 10:71956627-71956649 CCTCAGCTGCCAAACAGGGAAGG + Intergenic
1070361693 10:75696651-75696673 CCTCATCTGTAAAAGTGAGAGGG - Intronic
1070545991 10:77452966-77452988 TCTCATCTGGAAAACAGGGATGG + Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070713229 10:78698708-78698730 CCTCCTCTGCTGAAGCGGGGTGG - Intergenic
1070778152 10:79122216-79122238 CCTCATCTGCCAATGAGCGATGG + Intronic
1071256588 10:83877261-83877283 CCTCATCTGCAGTGGAGGGATGG - Intergenic
1072075900 10:91973568-91973590 TCTCATCTGCAAAACAGGAATGG - Intronic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073044893 10:100631146-100631168 CCTCATCTGTAAAACAGGGATGG + Intergenic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073541904 10:104321751-104321773 ACCCATCTGCAAAACAGGGATGG - Intronic
1074052083 10:109889056-109889078 CCTCATCTGCAAGGGCAGGGTGG + Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074662951 10:115682990-115683012 CATCTTCTGTAAAAGGGGGATGG + Intronic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG + Intergenic
1076491464 10:130864341-130864363 CCTCATCTGAAAAAGCGCAGGGG + Intergenic
1076898652 10:133326183-133326205 CCCCAACCGCAGAAGCGGGAGGG - Intronic
1078107476 11:8367700-8367722 CCTCATCTGTAAAATAGGAATGG - Intergenic
1078349489 11:10580933-10580955 TCTCATCTGTAAAAGAGAGAGGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079051673 11:17166163-17166185 CCTCAACTGTAAAATAGGGATGG + Intronic
1080846153 11:36028895-36028917 CCTCATCTGCAAAATGGAAATGG + Intronic
1081612732 11:44572756-44572778 CCTCATCTGTGAAATAGGGATGG + Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083502998 11:63128685-63128707 CCTCAGCTGCCAAATTGGGAAGG + Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1085477883 11:76799196-76799218 CCTCCTCTGCAAAACGGGGCAGG + Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085638376 11:78175380-78175402 CCTCATCTGCACAACAGGAATGG - Intronic
1086333068 11:85773146-85773168 CCACATCTGCAAAAACAAGAGGG + Intronic
1087269406 11:96096453-96096475 TCTCATCTGCAAAAGCGGGGAGG - Intronic
1088663955 11:112075239-112075261 CTTCATCTACAAAATAGGGATGG + Intronic
1088893264 11:114060461-114060483 CCTCCCCTGCAAAAGGGGGGTGG - Intronic
1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG + Intergenic
1089810354 11:121126336-121126358 CCTCATCTGCAGCAGCAGCAGGG - Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091901477 12:4147507-4147529 CCTCATTTGCAAAACAAGGATGG + Intergenic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096815410 12:54198821-54198843 CCTCATCTATAAAACGGGGATGG - Intergenic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1101173211 12:102120787-102120809 CTTCACCTGCAAAACCAGGAAGG - Intronic
1101815068 12:108139983-108140005 CCTCACCTGCAAAAGAGAGAGGG + Intronic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1101963818 12:109268568-109268590 CCTCATCTGCACAACAGGGGTGG - Intergenic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102809910 12:115815236-115815258 CCTCTTTTGCAAAAGAGGAAAGG - Intergenic
1102854170 12:116278180-116278202 TCTCCTCTGCAAAAGGCGGACGG - Intergenic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1104656469 12:130577188-130577210 TCTCATCTGTAAAACAGGGATGG + Intronic
1105916855 13:24924870-24924892 TCTCATCTGCAAAACAGGGGTGG + Intergenic
1107202068 13:37733407-37733429 CATCATCTCCAAAAGCTTGATGG - Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108323647 13:49309230-49309252 CCACAGCTGCCAAAGCGGGGAGG + Exonic
1110881421 13:80577445-80577467 CCCCAACTGCACAAGTGGGAAGG + Intergenic
1112030364 13:95451002-95451024 CCTCACCTGCAAAACGGGCATGG - Intronic
1112042079 13:95556593-95556615 TCTCATCTGTAAAACAGGGATGG - Intronic
1112515750 13:100051554-100051576 CCTCACCTCCAAAAGGGAGAGGG + Intergenic
1112521413 13:100098635-100098657 CAACATCTGCTACAGCGGGATGG + Intronic
1113961608 13:114129412-114129434 CCTCACCTGCAAGAGCTGGAAGG + Intronic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1121984666 14:98493138-98493160 CCTCATCTGTAAAGCAGGGATGG - Intergenic
1122059531 14:99127406-99127428 CCTCATCTGCAAAGCAGGGATGG - Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122267987 14:100555546-100555568 CCTCATCTGGAAAACGGGGTGGG - Intronic
1202891098 14_KI270722v1_random:158832-158854 CCTCAGCTGCCAAACAGGGAAGG + Intergenic
1123390565 15:19867137-19867159 CCTCAAATGCAAAAGTGGCACGG - Intergenic
1124356278 15:28997106-28997128 CCTCATCAGCAGAACAGGGATGG - Intronic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124517508 15:30379510-30379532 CCTCATCTGTAAAATTGCGATGG - Intronic
1124541142 15:30586745-30586767 CCTCATCTGTAAAATTGCGATGG + Intergenic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1125006370 15:34822256-34822278 CCTCACATGCTGAAGCGGGATGG - Intergenic
1125155412 15:36579689-36579711 CCCTAGCTGCAAAAGCGGGGCGG - Exonic
1126398459 15:48244360-48244382 CCTCATCTGCAAGAGAGCCAAGG - Intronic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128670744 15:69573032-69573054 CATCATCTGCTAAAGTAGGAAGG + Intergenic
1128733108 15:70034175-70034197 CCTCATCTGAAACAGCGGGGTGG - Intergenic
1128793005 15:70446893-70446915 CCTCATCTGTAAAACAAGGATGG + Intergenic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129857815 15:78837543-78837565 CCTCAGCGGCAAATGGGGGAGGG + Intronic
1129898759 15:79129516-79129538 CCTTATCTTGAAAAGCTGGAGGG - Intergenic
1130126693 15:81099724-81099746 CCTCATCTATAAAAAAGGGATGG - Intronic
1130403243 15:83576583-83576605 CATCACCTGAAAAAGCTGGAAGG + Exonic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131504902 15:93008868-93008890 CCTCATCTGCAAGAGAGGCATGG - Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131645003 15:94331958-94331980 CCTTATCTGCAAAAGAAAGATGG + Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1134014363 16:10878330-10878352 CCTCATCTGGAATTGAGGGAGGG - Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136409938 16:30070256-30070278 CCTCCTCTTCAAGAGTGGGAGGG - Exonic
1136624834 16:31456000-31456022 CTTCATCTGTAAAACAGGGATGG - Intergenic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141446224 16:84060390-84060412 CCTCACCTGTGAGAGCGGGACGG + Intronic
1141479324 16:84295819-84295841 TCTCATCTGCAAAAGACAGAGGG + Intronic
1141665900 16:85464965-85464987 CCTCACCTGCAAAAACGAGAGGG - Intergenic
1141996453 16:87639208-87639230 CCTCATCTGCAACGAGGGGAGGG - Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1142675547 17:1511221-1511243 CCTCAACTACAAAACAGGGACGG - Intronic
1143487303 17:7261945-7261967 GCTCATCTGCCACTGCGGGATGG + Exonic
1143867495 17:9934644-9934666 CCTCATCAGCAAACCAGGGAGGG - Intronic
1143906057 17:10210111-10210133 CCTCATCTGCAGGACAGGGATGG + Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144682003 17:17202400-17202422 CCACATCAGCCAAAGCAGGAGGG + Exonic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144848713 17:18233374-18233396 CCCCATCTGCAGAAGCTGGGAGG - Intronic
1144888355 17:18478835-18478857 CCTCATCTGTAAAAGTGGCCGGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145143851 17:20465467-20465489 CCTCATCTGTAAAAGTGGCCGGG - Intronic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145792019 17:27633226-27633248 CCTCATCTGTAAAAGTGGCCGGG + Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1145907844 17:28526025-28526047 CCTCATCTGCAACACGGGTATGG - Intronic
1146074028 17:29711530-29711552 CCCCATCTGTAAAAGCTAGAAGG - Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146668179 17:34718541-34718563 CCACATCTGTAAACACGGGAGGG + Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148798262 17:50207899-50207921 CCACATATGCAAAGGCAGGAGGG + Intergenic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1151477848 17:74353976-74353998 TTTCATCTGCAAATGGGGGATGG - Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152585553 17:81187997-81188019 CCCTGTCTGCAAAAGGGGGAAGG + Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152877257 17:82793933-82793955 CCTCATCTGCAGAGTCGGCATGG + Intronic
1153530237 18:6038870-6038892 CCTCATCTCCAAAAACCGTAGGG - Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1153750663 18:8226907-8226929 CCTCATCTCCAAAGGCAGGAAGG + Intronic
1153815617 18:8787476-8787498 CCTGATCTGCAGTAGTGGGACGG + Intronic
1155014150 18:21815642-21815664 CTTCATCTCCAAAAGCTGCATGG - Exonic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1157495955 18:48157711-48157733 CCTCATCTGTAAAAGCTGAGTGG + Intronic
1157597664 18:48873684-48873706 CCCCATCTGTAAAAGAAGGATGG + Intergenic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159116827 18:64123970-64123992 CCTCACCTCCAAAAGCAGAAGGG - Intergenic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1161067087 19:2243983-2244005 CCTCATCTGGAAGACGGGGACGG - Intronic
1161205828 19:3040919-3040941 GCTCATCTGGAAAAGGGGCATGG + Intronic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1162236344 19:9312640-9312662 CCTCAGCTGCCAAACAGGGAAGG + Intergenic
1162416774 19:10543462-10543484 CCTCATGTGCAAAATAGGGCTGG - Intergenic
1162448954 19:10742807-10742829 CCCCATCTGCAAAACAGGGTTGG + Intronic
1162475489 19:10896928-10896950 CTTCATTTGCAAAACCCGGAAGG - Intronic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1162728557 19:12703950-12703972 CCACATCTGCAAATGGGAGATGG + Intronic
1163522445 19:17799570-17799592 CCTCCTCTGCAAAGCTGGGATGG - Intronic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1166065125 19:40353504-40353526 CCTCATCTGAAAAACAGAGATGG + Intronic
1166914994 19:46189213-46189235 CCTCAGCTGCCAAACAGGGAAGG - Intergenic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168406197 19:56111871-56111893 CCTCCTCTGCAAAGCAGGGACGG + Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
1202666517 1_KI270708v1_random:125670-125692 CCTCAGCTGCCAAACAGGGAAGG + Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926589465 2:14724579-14724601 CCTCACCTGGAACAGAGGGAGGG + Intergenic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
927890622 2:26745855-26745877 CATCATTTGTAAAAGCTGGATGG + Intergenic
928904107 2:36353479-36353501 CCTCCTCTGCAAGAGTGGGAGGG + Intergenic
929273551 2:40000545-40000567 CCTCATCTGTAAAGCAGGGATGG - Intergenic
930031482 2:47060752-47060774 GCTCAGCTGCAAAAGCAGAAGGG - Exonic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931284238 2:60819174-60819196 CCTCATCTGCAGAACAGGGCTGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
932910110 2:75797393-75797415 CCTCATCTGAAAAACGGAGATGG + Intergenic
933782254 2:85810912-85810934 CCTCATCTGTAAAACCAGGGCGG - Intergenic
933851171 2:86367850-86367872 CCTCACCTGTAAAACAGGGATGG + Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937256759 2:120561189-120561211 CCTCAGCTGCAAAGGCTGCAAGG + Intergenic
937850111 2:126624370-126624392 CCTCATCTGGAAAATAAGGATGG - Intergenic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
942184373 2:173410653-173410675 CCTCATCTGGAAATGGGAGATGG - Intergenic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946413039 2:219525000-219525022 GCTCATCTGTAAAAGGGGAATGG - Intronic
946807884 2:223490017-223490039 CCTCATCTGAGAAATAGGGATGG + Intergenic
948639852 2:239368727-239368749 CCTCACCTGCAGAACAGGGAGGG - Intronic
1168966223 20:1899804-1899826 GCTCATCTGTAAAAGAGGAATGG + Intronic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172557129 20:35852074-35852096 CCTCATCTGCAAAATAAGAATGG - Intronic
1172645686 20:36467886-36467908 CCTTATCTGCAAAACAGGGATGG - Intronic
1173054422 20:39597479-39597501 CAACATCTGCAAAAGGGGGTTGG - Intergenic
1173153176 20:40585094-40585116 CCCCATCTGTAAAATAGGGATGG + Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173836594 20:46130081-46130103 CCACCTCTGTAAAAGAGGGAGGG - Intergenic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1175019405 20:55828337-55828359 CCTAATCTGCAACATGGGGATGG + Intergenic
1175072268 20:56344421-56344443 CTTCATCTGCAAAATCGAAATGG + Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1175838847 20:62014187-62014209 CCTCATCTGCAAAGTAGAGATGG - Intronic
1176096618 20:63347278-63347300 GCCCATCTGCAAAACGGGGAGGG - Intronic
1178087696 21:29128749-29128771 GCTCATCTGTCAAATCGGGATGG + Intronic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1180513702 22:16119213-16119235 CCTCAAATGCAAAAGTGGCATGG - Intergenic
1181802777 22:25358261-25358283 CCTCATCTGTGAAAGAGGAAGGG - Intronic
1181956086 22:26589189-26589211 CCCCATCTGTAAAAGGGGAAGGG + Intronic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183080914 22:35455833-35455855 CTTCATCTGTAAAAGCCGAATGG - Intergenic
1183228662 22:36567138-36567160 CCTCATCTGTAAAGCAGGGATGG + Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183389710 22:37538579-37538601 CCTCTTCTGTAAAGGGGGGAAGG - Intergenic
1183630291 22:39028431-39028453 CCTCCTCTGTAAAATAGGGATGG + Intronic
1183740492 22:39666138-39666160 CCTCTTCTGCAAAATGGGTAAGG + Intronic
1183747006 22:39697852-39697874 CCTCATTCGCAGAAGCAGGAAGG - Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184650197 22:45916125-45916147 ACCCATCTGGAAAAGTGGGATGG + Intergenic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
949770957 3:7577678-7577700 TGTCATCTGCAAATGGGGGATGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952654865 3:35773328-35773350 CATCATCTGTAAAATAGGGAAGG - Intronic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
954619272 3:51986398-51986420 CCTCATCTGTAAAAGCAGCAGGG - Exonic
954623127 3:52006865-52006887 CCTCATCTGTAAAAGAGGTCTGG + Intergenic
954867148 3:53739367-53739389 CCTTATCTGCAAAGGCGAGTTGG - Intronic
955977502 3:64492392-64492414 CCACATCTGCAAAAGAGGCTGGG + Intergenic
956093481 3:65692562-65692584 CCTTATCTACAAAATGGGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956886521 3:73565479-73565501 CCTCATCTGAAAAGGAGAGAAGG + Intronic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957089379 3:75713938-75713960 CCTCAGCTGCCAAACAGGGAAGG - Intronic
959021794 3:101195529-101195551 CCTCATCTGTAAATGGGGGCTGG - Intergenic
959111228 3:102124827-102124849 ACTCATCTGCAAAAGCAACATGG + Intronic
961363117 3:126380447-126380469 CCTCATTTGGAAAAGCGAGATGG - Intergenic
961380723 3:126494961-126494983 CCTCATCTGCAAAGCGGAGACGG - Intronic
962985244 3:140530614-140530636 CCACATCTGCTGAAGCTGGATGG - Intronic
965507714 3:169534755-169534777 CCTCCTCTGTAAAATAGGGATGG - Intronic
965603108 3:170473858-170473880 TCTCATCTGCAAAACGGGGTTGG + Intronic
966298552 3:178452438-178452460 CATCATCTGCAAAGGCATGAAGG + Intronic
966815276 3:183885080-183885102 CCTCATCTGCAAATGCCGGGAGG - Intergenic
966890763 3:184406012-184406034 CCTCATCTGCAACATAGGGATGG - Intronic
968283925 3:197497128-197497150 TCTCATCTGTAAAAGAGGGGAGG + Intergenic
969045698 4:4335009-4335031 CCTCGGCTGCCAAACCGGGAAGG - Intergenic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
970445281 4:16118714-16118736 CATCCTCTGCAAAACAGGGATGG + Intergenic
970599453 4:17629359-17629381 CCTCATCTGCAGAATCCAGATGG + Exonic
972001569 4:34042243-34042265 CAACATCTGTAAAAGAGGGAAGG - Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
975193078 4:71489427-71489449 TCCCATCTGCAACATCGGGATGG + Intronic
975377793 4:73665729-73665751 CCTCAGCTGCCAAACAGGGAAGG - Intergenic
975378430 4:73671138-73671160 CCTCAGCTGCCAAACAGGGAAGG - Intergenic
975579331 4:75892476-75892498 CCTCATCTGGAAAAGGGGCGGGG + Intronic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976793579 4:88907867-88907889 CCTCATCTGTAAAATCAGGGAGG - Intronic
978308086 4:107354094-107354116 CCTCAGCTGCCAAATAGGGAAGG - Intergenic
978570847 4:110135308-110135330 CTTTATCTGCAAATGGGGGATGG - Intronic
982462698 4:155690753-155690775 CCTCTGCTGCAAAAAGGGGAGGG - Intronic
984408803 4:179369541-179369563 CCTCAACTGCAAAAGGACGAGGG - Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
991511407 5:67380756-67380778 CCTCATCAGCAAAAACCAGATGG + Intergenic
992300142 5:75369569-75369591 CCTCATCTGTAAAACAGGGGTGG + Intronic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
996752505 5:126903214-126903236 CCTCAACTGTAAATGCAGGAAGG + Intronic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999300858 5:150489524-150489546 CCTCATCTGAAAATGGGGCAGGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000460846 5:161516353-161516375 CCTCATCTGCAAAGCAGGGGTGG - Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001775750 5:174327960-174327982 CCTTATCTGTAAAAATGGGACGG + Intergenic
1001953630 5:175833294-175833316 TCTCATCTGCAAAATCAGGGTGG - Intronic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002155084 5:177271415-177271437 CCTCATCTGCAAGATCAGGATGG - Intronic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1003480358 6:6525526-6525548 CATCATCTGTAAAACAGGGAAGG + Intergenic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1007107959 6:39296272-39296294 CCTCACCTGTAAAAGGGGGCTGG - Intergenic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008979317 6:57464896-57464918 TCTTATCTGAAAAAGAGGGACGG - Intronic
1010189630 6:73181852-73181874 CTTTATCTGCAAAACAGGGATGG + Intronic
1010831098 6:80530519-80530541 TCTCATCTGTAAAATCTGGAAGG - Intergenic
1011580317 6:88855947-88855969 CATCATCTGCAAAAATGGCATGG + Intronic
1012775652 6:103490875-103490897 CCTCATATGCAAAAGGGGAGAGG + Intergenic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013199376 6:107878134-107878156 CCTCATTTACAAAAACAGGAAGG + Intronic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1016676328 6:146773607-146773629 CTTCATCTGTAAAACTGGGATGG - Intronic
1016988118 6:149910130-149910152 CCTCTTCTGCCACAGCGGGAGGG + Intergenic
1019182926 6:170203125-170203147 CCTGGTCTGCACAAGCTGGAAGG + Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021675646 7:23077863-23077885 CCTCATCTGTAAAACAGGGGTGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022497347 7:30861408-30861430 CCTCCTCTGAAAAACAGGGATGG - Intronic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1026052918 7:66961851-66961873 CCTCATCTGTAAAACAAGGATGG + Intergenic
1026104764 7:67411977-67411999 CCTCATCTGTAAAAACAAGAAGG + Intergenic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1027269545 7:76512249-76512271 CCTCATCTGTAAGAGCGGGTAGG - Intronic
1027320256 7:77006143-77006165 CCTCATCTGTAAGAGCGGGTAGG - Intergenic
1028745700 7:94323991-94324013 CCTCATCTGCCAAAGGGGAAGGG - Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033192671 7:139296356-139296378 CTTCATGTGCAAAAGCAGGCAGG + Intronic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1038367918 8:26955738-26955760 CATCATCTGCAAAAATGAGATGG - Intergenic
1038477563 8:27878786-27878808 CCTCATTTGAAAAACAGGGATGG + Intronic
1040566930 8:48575925-48575947 CCTCATCTGCAAAACAAGGTGGG - Intergenic
1042692993 8:71524224-71524246 CCTCATCTGGTAAATTGGGAGGG - Intronic
1042817416 8:72892574-72892596 CCTCATCTACAAAATATGGATGG - Intronic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044844236 8:96364565-96364587 CCTCATCTGAAATATCTGGAGGG + Intergenic
1044844314 8:96365402-96365424 CCTCATCTATAAAATAGGGATGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045362520 8:101446050-101446072 CTTCATCTGAAAAACAGGGATGG - Intergenic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045421781 8:102023599-102023621 TCTCATCTGCAAAAGTGCCAGGG + Intronic
1047269743 8:123344883-123344905 CCTCTTCTGGCAAAGCGGAATGG + Exonic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047761365 8:127957100-127957122 CCACATGTGCAAAATAGGGATGG - Intergenic
1048207017 8:132423425-132423447 CATCATCTGAAAAGGCAGGAAGG + Intronic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1050758707 9:9039492-9039514 CCTTATTTACAAAAGCAGGATGG - Intronic
1050772559 9:9220852-9220874 CCTCTTCAGTAAAAGCTGGAGGG - Intronic
1050853762 9:10323308-10323330 CCCCATCTGAAAAAGAGGAAGGG - Intronic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1053708535 9:40781443-40781465 CCTCAAATGCAAAAGTGGCATGG + Intergenic
1054418446 9:64902238-64902260 CCTCAAATGCAAAAGTGGCATGG + Intergenic
1054822503 9:69537541-69537563 CCTCTTCTGGAAAGGAGGGAAGG + Intronic
1056763315 9:89429403-89429425 TCTTAGCTGCAAAAGAGGGATGG - Intronic
1056812426 9:89775068-89775090 ACTGATCTGCAAGAGCTGGAGGG - Intergenic
1057204865 9:93165240-93165262 CCTTATTTGCAAAAGCAGAATGG + Intergenic
1057695569 9:97320600-97320622 CCTCCTCTGTAAAATAGGGATGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058413609 9:104762862-104762884 CCTCATCTGCCACAGAAGGAAGG + Intergenic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1059441064 9:114307150-114307172 CCTCCTCTGCACAAGCGGCTGGG + Intronic
1059515863 9:114894609-114894631 CCTCATCTGCAACATGGGAATGG + Intronic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059623063 9:116030088-116030110 CATCATATGCAAAGGCAGGAAGG - Intergenic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060034507 9:120243412-120243434 CCTCATCTACAAAAGAGAAATGG - Intergenic
1060141256 9:121212337-121212359 CCTCATCTGTAAAATAGGTATGG + Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1060588308 9:124800427-124800449 CCTCATCTGCCAAATGGGCAGGG - Intronic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1061876570 9:133547030-133547052 CTTCGTCTGCAAGAGCTGGAAGG - Exonic
1203488221 Un_GL000224v1:78056-78078 CCTCAGCTGCCAAACAGGGAAGG + Intergenic
1203500842 Un_KI270741v1:19952-19974 CCTCAGCTGCCAAACAGGGAAGG + Intergenic
1203613363 Un_KI270749v1:28641-28663 CCGCATCAGCAAATGCAGGAGGG - Intergenic
1185687271 X:1939596-1939618 CCTCATCTGCAAAGTCAGGCAGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1188875012 X:35418744-35418766 CCTCATCTGCAAATGAGGTCTGG - Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189409948 X:40761172-40761194 GCTCATCTGCCACTGCGGGATGG + Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190916345 X:54814057-54814079 CCTCAACTGTAAAACGGGGATGG - Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192238263 X:69309892-69309914 CCTCATCTGGAAAACAGGGATGG + Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1195916014 X:109936045-109936067 CCTCATCTGTAATATAGGGATGG + Intergenic
1195928310 X:110048514-110048536 CCACATCTGTAAAAGAGGGCGGG - Intronic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197306265 X:124845713-124845735 CCTTATCTTAAAAAGTGGGAGGG - Intronic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198551487 X:137749778-137749800 CCTCATCTGAAAAATTGAGAAGG + Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1201543807 Y:15138512-15138534 CCTCAGCTGCCAAACTGGGAAGG + Intergenic