ID: 1070627477

View in Genome Browser
Species Human (GRCh38)
Location 10:78061604-78061626
Sequence AGAGCCCCAGCTTCTCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070627477_1070627478 -5 Left 1070627477 10:78061604-78061626 CCTCTGAGAGAAGCTGGGGCTCT No data
Right 1070627478 10:78061622-78061644 GCTCTCTTCAGCCCCATGAGTGG No data
1070627477_1070627483 26 Left 1070627477 10:78061604-78061626 CCTCTGAGAGAAGCTGGGGCTCT No data
Right 1070627483 10:78061653-78061675 TCCAGCCCTCTTTCTGAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070627477 Original CRISPR AGAGCCCCAGCTTCTCTCAG AGG (reversed) Intergenic
No off target data available for this crispr