ID: 1070630559

View in Genome Browser
Species Human (GRCh38)
Location 10:78081727-78081749
Sequence CCTTCCCAGCCACCCAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070630559_1070630566 27 Left 1070630559 10:78081727-78081749 CCATGTTTGGGTGGCTGGGAAGG No data
Right 1070630566 10:78081777-78081799 CTGTGTAGAGAGCGGGAGCAAGG No data
1070630559_1070630563 19 Left 1070630559 10:78081727-78081749 CCATGTTTGGGTGGCTGGGAAGG No data
Right 1070630563 10:78081769-78081791 AAGCCTGTCTGTGTAGAGAGCGG No data
1070630559_1070630564 20 Left 1070630559 10:78081727-78081749 CCATGTTTGGGTGGCTGGGAAGG No data
Right 1070630564 10:78081770-78081792 AGCCTGTCTGTGTAGAGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070630559 Original CRISPR CCTTCCCAGCCACCCAAACA TGG (reversed) Intergenic
No off target data available for this crispr