ID: 1070630566

View in Genome Browser
Species Human (GRCh38)
Location 10:78081777-78081799
Sequence CTGTGTAGAGAGCGGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070630559_1070630566 27 Left 1070630559 10:78081727-78081749 CCATGTTTGGGTGGCTGGGAAGG No data
Right 1070630566 10:78081777-78081799 CTGTGTAGAGAGCGGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070630566 Original CRISPR CTGTGTAGAGAGCGGGAGCA AGG Intergenic
No off target data available for this crispr