ID: 1070635683

View in Genome Browser
Species Human (GRCh38)
Location 10:78125376-78125398
Sequence CAGTAGAAACAGAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070635680_1070635683 3 Left 1070635680 10:78125350-78125372 CCTCAGGTAGCTTACAATGGTAG No data
Right 1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070635683 Original CRISPR CAGTAGAAACAGAGTGAGGA AGG Intergenic
No off target data available for this crispr