ID: 1070637727

View in Genome Browser
Species Human (GRCh38)
Location 10:78142549-78142571
Sequence CTGTAAAACCAAAAGCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070637727_1070637731 -6 Left 1070637727 10:78142549-78142571 CCAACTTGCTTTTGGTTTTACAG No data
Right 1070637731 10:78142566-78142588 TTACAGGCTCATAGGCAGAAGGG 0: 715
1: 1101
2: 1551
3: 1346
4: 1096
1070637727_1070637730 -7 Left 1070637727 10:78142549-78142571 CCAACTTGCTTTTGGTTTTACAG No data
Right 1070637730 10:78142565-78142587 TTTACAGGCTCATAGGCAGAAGG 0: 747
1: 1140
2: 1695
3: 1474
4: 1122
1070637727_1070637733 28 Left 1070637727 10:78142549-78142571 CCAACTTGCTTTTGGTTTTACAG No data
Right 1070637733 10:78142600-78142622 CTCAGATGAGACTTTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070637727 Original CRISPR CTGTAAAACCAAAAGCAAGT TGG (reversed) Intergenic
No off target data available for this crispr