ID: 1070640423

View in Genome Browser
Species Human (GRCh38)
Location 10:78164944-78164966
Sequence CTGTCCATATGGACAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070640423_1070640429 12 Left 1070640423 10:78164944-78164966 CCTTCTGCTGTCCATATGGACAG No data
Right 1070640429 10:78164979-78165001 ATTCATGAAACAGTTTGCTACGG No data
1070640423_1070640430 13 Left 1070640423 10:78164944-78164966 CCTTCTGCTGTCCATATGGACAG No data
Right 1070640430 10:78164980-78165002 TTCATGAAACAGTTTGCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070640423 Original CRISPR CTGTCCATATGGACAGCAGA AGG (reversed) Intergenic
No off target data available for this crispr