ID: 1070642151

View in Genome Browser
Species Human (GRCh38)
Location 10:78177863-78177885
Sequence CTTTGAGAGGGGAAGACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070642143_1070642151 23 Left 1070642143 10:78177817-78177839 CCGGAGGTGGGATGAAGCGAACA No data
Right 1070642151 10:78177863-78177885 CTTTGAGAGGGGAAGACAACTGG No data
1070642144_1070642151 -5 Left 1070642144 10:78177845-78177867 CCTTTTATCTCCCCGTCGCTTTG No data
Right 1070642151 10:78177863-78177885 CTTTGAGAGGGGAAGACAACTGG No data
1070642141_1070642151 25 Left 1070642141 10:78177815-78177837 CCCCGGAGGTGGGATGAAGCGAA No data
Right 1070642151 10:78177863-78177885 CTTTGAGAGGGGAAGACAACTGG No data
1070642142_1070642151 24 Left 1070642142 10:78177816-78177838 CCCGGAGGTGGGATGAAGCGAAC No data
Right 1070642151 10:78177863-78177885 CTTTGAGAGGGGAAGACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070642151 Original CRISPR CTTTGAGAGGGGAAGACAAC TGG Intergenic
No off target data available for this crispr