ID: 1070642621

View in Genome Browser
Species Human (GRCh38)
Location 10:78180531-78180553
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070642615_1070642621 17 Left 1070642615 10:78180491-78180513 CCAGAGCAGCACAGTGCATTTAG No data
Right 1070642621 10:78180531-78180553 AGGTCAGCCCCGGCCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070642621 Original CRISPR AGGTCAGCCCCGGCCAGAGC AGG Intergenic