ID: 1070642640

View in Genome Browser
Species Human (GRCh38)
Location 10:78180594-78180616
Sequence AGAGTGCCTTGGACTACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070642640_1070642642 -5 Left 1070642640 10:78180594-78180616 CCATGGGTAGTCCAAGGCACTCT No data
Right 1070642642 10:78180612-78180634 ACTCTGTCCTTCCCTCCACCCGG No data
1070642640_1070642649 22 Left 1070642640 10:78180594-78180616 CCATGGGTAGTCCAAGGCACTCT No data
Right 1070642649 10:78180639-78180661 TGCAGCCTGACCAAGTTTTCCGG No data
1070642640_1070642650 23 Left 1070642640 10:78180594-78180616 CCATGGGTAGTCCAAGGCACTCT No data
Right 1070642650 10:78180640-78180662 GCAGCCTGACCAAGTTTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070642640 Original CRISPR AGAGTGCCTTGGACTACCCA TGG (reversed) Intergenic