ID: 1070642641

View in Genome Browser
Species Human (GRCh38)
Location 10:78180605-78180627
Sequence GAGGGAAGGACAGAGTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070642641_1070642653 29 Left 1070642641 10:78180605-78180627 CCAAGGCACTCTGTCCTTCCCTC No data
Right 1070642653 10:78180657-78180679 TCCGGGCTCCCCCTTCTCCCTGG No data
1070642641_1070642650 12 Left 1070642641 10:78180605-78180627 CCAAGGCACTCTGTCCTTCCCTC No data
Right 1070642650 10:78180640-78180662 GCAGCCTGACCAAGTTTTCCGGG No data
1070642641_1070642655 30 Left 1070642641 10:78180605-78180627 CCAAGGCACTCTGTCCTTCCCTC No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
1070642641_1070642649 11 Left 1070642641 10:78180605-78180627 CCAAGGCACTCTGTCCTTCCCTC No data
Right 1070642649 10:78180639-78180661 TGCAGCCTGACCAAGTTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070642641 Original CRISPR GAGGGAAGGACAGAGTGCCT TGG (reversed) Intergenic