ID: 1070642643

View in Genome Browser
Species Human (GRCh38)
Location 10:78180619-78180641
Sequence GCAGTAACCGGGTGGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070642643_1070642656 17 Left 1070642643 10:78180619-78180641 CCTTCCCTCCACCCGGTTACTGC No data
Right 1070642656 10:78180659-78180681 CGGGCTCCCCCTTCTCCCTGGGG No data
1070642643_1070642650 -2 Left 1070642643 10:78180619-78180641 CCTTCCCTCCACCCGGTTACTGC No data
Right 1070642650 10:78180640-78180662 GCAGCCTGACCAAGTTTTCCGGG No data
1070642643_1070642655 16 Left 1070642643 10:78180619-78180641 CCTTCCCTCCACCCGGTTACTGC No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
1070642643_1070642649 -3 Left 1070642643 10:78180619-78180641 CCTTCCCTCCACCCGGTTACTGC No data
Right 1070642649 10:78180639-78180661 TGCAGCCTGACCAAGTTTTCCGG No data
1070642643_1070642653 15 Left 1070642643 10:78180619-78180641 CCTTCCCTCCACCCGGTTACTGC No data
Right 1070642653 10:78180657-78180679 TCCGGGCTCCCCCTTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070642643 Original CRISPR GCAGTAACCGGGTGGAGGGA AGG (reversed) Intergenic