ID: 1070642644

View in Genome Browser
Species Human (GRCh38)
Location 10:78180623-78180645
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070642644_1070642649 -7 Left 1070642644 10:78180623-78180645 CCCTCCACCCGGTTACTGCAGCC No data
Right 1070642649 10:78180639-78180661 TGCAGCCTGACCAAGTTTTCCGG No data
1070642644_1070642656 13 Left 1070642644 10:78180623-78180645 CCCTCCACCCGGTTACTGCAGCC No data
Right 1070642656 10:78180659-78180681 CGGGCTCCCCCTTCTCCCTGGGG No data
1070642644_1070642655 12 Left 1070642644 10:78180623-78180645 CCCTCCACCCGGTTACTGCAGCC No data
Right 1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG No data
1070642644_1070642650 -6 Left 1070642644 10:78180623-78180645 CCCTCCACCCGGTTACTGCAGCC No data
Right 1070642650 10:78180640-78180662 GCAGCCTGACCAAGTTTTCCGGG No data
1070642644_1070642653 11 Left 1070642644 10:78180623-78180645 CCCTCCACCCGGTTACTGCAGCC No data
Right 1070642653 10:78180657-78180679 TCCGGGCTCCCCCTTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070642644 Original CRISPR GGCTGCAGTAACCGGGTGGA GGG (reversed) Intergenic